 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ypuA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ypuA | + | 2435238..2436110 | COG4086 | x1082-BAC |
| Operon evidence: | Northern blotting (0.8 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Azevedo V, et al. (1993), Genbank L09228 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAGCGCCGAAAAATCGGCGTTTCTTTTATTGCTT >>>>>> <<<<<< |
ypuA |
|