Regulated Operon: | ypuA |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
ypuA | + | 2435238..2436110 | COG4086 | x1082-BAC |
Operon evidence: | Northern blotting (0.8 kb transcript); upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Azevedo V, et al. (1993), Genbank L09228 |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAGCGCCGAAAAATCGGCGTTTCTTTTATTGCTT >>>>>> <<<<<< |
ypuA |
|