 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yqjPQ-dsdA-coaA-yqjT |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yqjP | - | 2470976..2471935 | COG0491 | |||
| yqjQ | - | 2470191..2470970 | COG0300 | |||
| dsdA | yqjR | - | 2468769..2470115 | D-serine dehydratase | COG3048 | dsdA-BAC |
| coaA | yqjS | - | 2467738..2468697 | pantothenate kinase | ||
| yqjT | - | 2467348..2467734 | COG0346 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter in front of coaA |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GTTTGCGGGAGAGATTCATTCTCTTCCGTTTTTTATTTAAAGC >>>>>>>>> <<<<<<<<< |
yqjT |
|