| Regulated Operon: | yqjYZ-yqkABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yqjY | - | 2462760..2463230 | COG0454 | |||
| yqjZ | - | 2462406..2462750 | COG2329 | |||
| yqkA | - | 2461382..2462413 | COG2320 | x0490-BAC yqkA-BAC | ||
| yqkB | - | 2461062..2461385 | COG4918 | |||
| yqkC | - | 2460810..2461049 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of internal promoters in front of yqkB and yqkC |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGAAAGAGCCGAAGAGGCCTTTCGCTTTTTTATTCTGTTG >>>>>>>>>>> <<<<<<<<<< |
yqkC |


|