Regulated Operon: | yqjYZ-yqkABC |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
yqjY | - | 2462760..2463230 | COG0454 | |||
yqjZ | - | 2462406..2462750 | COG2329 | |||
yqkA | - | 2461382..2462413 | COG2320 | x0490-BAC yqkA-BAC | ||
yqkB | - | 2461062..2461385 | COG4918 | |||
yqkC | - | 2460810..2461049 |
Operon evidence: | Northern blotting |
---|---|
Reference: | BSORF |
Comments: | Northern blotting results in BSORF suggest the existence of internal promoters in front of yqkB and yqkC |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGCGAAAGAGCCGAAGAGGCCTTTCGCTTTTTTATTCTGTTG >>>>>>>>>>> <<<<<<<<<< |
yqkC |
|