 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yrvE-apt |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yrvE | - | 2822645..2825005 | COG0608 | |||
| apt | - | 2822127..2822639 | adenine phosphoribosyltransferase | COG0503 | apt-STA apt-STR |
| Operon evidence: | Northern blotting (3.0 kb transcript) |
|---|---|
| Reference: | Nickel M, et al. (2004) |
| Comments: | Internal promoter in front of apt, leading to a 0.6 kb transcript. Readthrough at this terminator leads to a 5.8 kb yrvE-apt-relA-yrvI transcript and a 3.3 kb apt-relA-yrvI transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCACTCCATGTCAGGGTGCTTTTTTCCTATTGTT >>>>>> <<<<<< |
apt |
|