 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ytcJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ytcJ | - | 3021107..3022696 | COG1574 |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAAGGACAGGCAGCAGCCTGTCCTTTTATTTTCTATAA >>>>>>>> <<<<<<<< |
ytcJ |
|