| Regulated Operon: | ytqI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ytqI | - | 2994947..2995888 | COG0618 | ytqI-BAC |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAGAACACGAGTAGAGGGGAGACCCTCTCTCTTAGTGTTCATCTGT >>>>>>>>>> <<<<<<<<< |
ytqI |


|