Regulated Operon: | ytqI |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
ytqI | - | 2994947..2995888 | COG0618 | ytqI-BAC |
Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Lapidus A, et al. (1997), Genbank AF008220 |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
TAAAGAACACGAGTAGAGGGGAGACCCTCTCTCTTAGTGTTCATCTGT >>>>>>>>>> <<<<<<<<< |
ytqI |
|