| Regulated Operon: | ytsP | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ytsP | + | 3032464..3032700 | COG1956 | 
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 | 
| Comments: | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| TAAAAGCCCAAAACTGATATCGTTTTGGGCTTTTTTTATTTTATT >>>>>>>>> <<<<<<<<<  | 
  ytsP | 


  |