| Regulated Operon: | yugE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yugE | mtnE | - | 3227472..3227738 |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Oudega B, et al. (1997), Genbank Z93934 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCGGTTCAGCACCGGTTTTTTTGTTATTTG >>>>> <<<<< |
yugE |


|