Regulated Operon: | yugF |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
yugF | + | 3226622..3227443 | COG0596 |
Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Oudega B, et al. (1997), Genbank Z93934 |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACCGGTGCTGAACCGGTTTTTTTAAGGCGTG >>>>> <<<<< |
yugF |
|