| Regulated Operon: | yurRQPONML |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yurR | - | 3351816..3352934 | COG0665 | x0835-BAC | ||
| yurQ | - | 3351339..3351713 | COG0322 | |||
| yurP | - | 3350137..3351123 | COG2222 | |||
| yurO | - | 3348788..3350056 | COG1653 | |||
| yurN | - | 3347852..3348730 | COG1175 | |||
| yurM | - | 3346946..3347848 | COG0395 | |||
| yurL | - | 3346078..3346932 | COG0524 |
| Operon evidence: | Northern blotting (7.5 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: | The long mRNA molecule agrees poorly with the sequence and with the microarray data. The Northern blotting results also showed yurP (1.0 kb) and yurPO (2.5 kb) transcripts. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACGAGAATACTATAAGCAGTGTCTCGTTTTTTATGCCTGTT >>>>>>>>>> <<<<<<<<< |
yurL |


|