| Regulated Operon: | yvtA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yvtA | yvtB, htrB | - | 3383097..3384473 | 
| Operon evidence: | upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | |
| Comments: | 
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| CssR | Positive | ND | ND | ND | 
  Darmon E, et al. (2002): RG | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| AAAAAGCTGAACCCGATTAAGGTTCAGCTTTTTTGTTACCCTA >>>>>>>> <<<<<<<<  | 
  yvtA | 


  |