| Regulated Operon: | yvtA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yvtA | yvtB, htrB | - | 3383097..3384473 |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CssR | Positive | ND | ND | ND |
Darmon E, et al. (2002): RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCTGAACCCGATTAAGGTTCAGCTTTTTTGTTACCCTA >>>>>>>> <<<<<<<< |
yvtA |


|