 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | ywaA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywaA | ipa-0r | + | 3956412..3957503 | COG0115 | ywaA-BAC |
| Operon evidence: | Northern blotting (1.3 kb transcript); downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000), Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCCGGCCCATTACAGGCCGGCTTTTTTTACGCTTCA >>>>>>> <<<<<<< |
ywaA |
|