Regulated Operon: | ywaA |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
ywaA | ipa-0r | + | 3956412..3957503 | COG0115 | ywaA-BAC |
Operon evidence: | Northern blotting (1.3 kb transcript); downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000), Presecan E, et al. (1997) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGCCGGCCCATTACAGGCCGGCTTTTTTTACGCTTCA >>>>>>> <<<<<<< |
ywaA |
|