| Regulated Operon: | ywdH | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywdH | ipa-58r | + | 3895305..3896678 | COG1012 | x0897-BAC | 
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | Presecan E, et al. (1997) | 
| Comments: | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| AAAAAGCGCAGATCACCTGCGCTTTTTACAAATCCTT >>>>>> <<<<<<  | 
  ywdH | 


  |