| Regulated Operon: | ywjG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| ywjG | + | 3809113..3809634 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Trach K, et al. (1988) |
| Comments: | The terminator proposed by Trach, near the ywjG stop codon, lacks a T-stretch. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGACTTGCCCGCTTTTGACAAACGGCAAGTCTTTTTTATTACTTCT >>>>>>>> <<<<<<<< |
ywjG |


|