| Regulated Operon: | ywjG | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywjG | + | 3809113..3809634 | 
| Operon evidence: | Genome analysis | 
|---|---|
| Reference: | Trach K, et al. (1988) | 
| Comments: | The terminator proposed by Trach, near the ywjG stop codon, lacks a T-stretch. | 
  
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| AAAAAGACTTGCCCGCTTTTGACAAACGGCAAGTCTTTTTTATTACTTCT >>>>>>>> <<<<<<<<  | 
  ywjG | 


  |