Regulated Operon: | ywjG |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
ywjG | + | 3809113..3809634 |
Operon evidence: | Genome analysis |
---|---|
Reference: | Trach K, et al. (1988) |
Comments: | The terminator proposed by Trach, near the ywjG stop codon, lacks a T-stretch. |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGACTTGCCCGCTTTTGACAAACGGCAAGTCTTTTTTATTACTTCT >>>>>>>> <<<<<<<< |
ywjG |
|