| Regulated Operon: | ywpE | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| ywpE | - | 3740758..3741066 | COG3764 | 
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand | 
|---|---|
| Reference: | Presecan E, et al. (1997), Genbank Z83337 | 
| Comments: | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| GAAAAGCTGCCGTTCAAAACGGCAGCTTTTTTCATGCAGAA >>>>>>>>> <<<<<<<<<  | 
  ywpE | 


  |