Regulated Operon: | ywpE |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
ywpE | - | 3740758..3741066 | COG3764 |
Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Presecan E, et al. (1997), Genbank Z83337 |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GAAAAGCTGCCGTTCAAAACGGCAGCTTTTTTCATGCAGAA >>>>>>>>> <<<<<<<<< |
ywpE |
|