Regulated Operon: | yxaI |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
yxaI | + | 4103467..4103922 | COG1714 |
Operon evidence: | Northern blotting (0.6 kb transcript); upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAAGTCTAGACGCCAATAGGCATCTAGACTTTTGTTTTCTTTGC >>>>>>>>>>> <<<<<<<<<<< |
yxaI |
|