 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yxeFGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxeF | - | 4064090..4064524 | ||||
| yxeG | - | 4063552..4064109 | ||||
| yxeH | - | 4062700..4063512 | COG0561 |
| Operon evidence: | Northern blotting (2.5 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000), BSORF |
| Comments: | Internal promoter in front of yxeH, leading to a 0.9 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAATCCAGCCTTCTAAAGGCTGGATCTTTTCGTTTTATTTG >>>>>>>>>> <<<<<<<<<< |
yxeH |
|