| Regulated Operon: | yxiD-yxxD-yxxE | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yxiD | - | 4035802..4037511 | ||||
| yxxD | - | 4035362..4035805 | ||||
| yxxE | - | 4035008..4035316 | 
| Operon evidence: | Genome analysis | 
|---|---|
| Reference: | Le Coq D, et al. (1995), Yoshida K, et al. (2000) | 
| Comments: | yxiD and yxxD overlap. Northern blotting by Yoshida et al. showed one 1 kb transcript in the yxiD-yxxD region and one 700 bp transcript for yxxE. Both of these transcripts are too long to infer that these genes are transcribed monocistronically, but too short to cover a yxiD-yxxD-yxxE operon. | 
  
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| CATAACCTTGATTGGAAAAAATGCCTTTCAAGGTTTTTAATTACAATA >>>>>>>>>> <<<<<<<<<<  | 
  yxxE | 


  |