| Regulated Operon: | yxiD-yxxD-yxxE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxiD | - | 4035802..4037511 | ||||
| yxxD | - | 4035362..4035805 | ||||
| yxxE | - | 4035008..4035316 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Le Coq D, et al. (1995), Yoshida K, et al. (2000) |
| Comments: | yxiD and yxxD overlap. Northern blotting by Yoshida et al. showed one 1 kb transcript in the yxiD-yxxD region and one 700 bp transcript for yxxE. Both of these transcripts are too long to infer that these genes are transcribed monocistronically, but too short to cover a yxiD-yxxD-yxxE operon. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CATAACCTTGATTGGAAAAAATGCCTTTCAAGGTTTTTAATTACAATA >>>>>>>>>> <<<<<<<<<< |
yxxE |


|