| Regulated Operon: | yxiO |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxiO | + | 4013700..4014986 | COG2270 |
| Operon evidence: | Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000), BSORF |
| Comments: | The Northern blotting results also show a 0.7 kb transcript, which would be too short to cover yxiO. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCTGACACACCGTCAATTTTGGCAATCGTTCCTACAAAATCAACGGCTCTGATTTTCTTTTTCTTTC >>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<< |
yxiO |


|