Regulated Operon: | yxkD |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
---|---|---|---|---|---|---|
yxkD | - | 3986946..3987782 | COG1284 | yxkD-BAC |
Operon evidence: | Northern blotting (1.1 kb transcript); upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2000) |
Comments: |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAATCCCTCTGTACTTGAAACAGAGGGATTTTTTCATTTAGAA >>>>>>>>> <<<<<<<<< |
yxkD |
|