 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yxkH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxkH | - | 3982206..3983045 | COG0726 |
| Operon evidence: | Northern blotting; downstream gene is on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000), BSORF |
| Comments: | A 1.0 kb and a 1.2 kb transcript was found. The significance of the two transcript lengths is unknown. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCTGTCCGCCTGCTGGCGGCTTTTGTTTTTCGAGG >>>>> <<<<< |
yxkH |
|