 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yxlJ-yxzF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yxlJ | - | 3963298..3963888 | COG2094 | |||
| yxzF | - | 3963111..3963269 |
| Operon evidence: | Northern blotting (0.9 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000), Tobisch S, et al. (1997) |
| Comments: | The 0.9 kb transcript is sufficient to cover both yxlJ and yxzF. The figure in Yoshida's paper suggests a yxlJ-yxzF transcript, but such an operon is not mentioned in the text. Internal promoter in front of yxzF. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGAACAGCCGGCTGATCCCGGCTGTTTTTTTATAGGTCA >>>>>>> <<<<<<< |
yxzF |
|