 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yyaC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yyaC | + | 4203924..4204541 |
| Operon evidence: | Northern blotting; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigF | Promoter | -35:+9 | 4203821..4203864 | CAAAGCATAAAAAATCATACTGCTGGATATACTGTAAACAACCT |
Wang S, et al. (2006): AR, Race-PCR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCATCTTCGTTTGAAAGATGGTTTTTTCATTTATGA >>>>>>>> <<<<<<<<< |
yyaC |
|