| Regulated Operon: | yyaC | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters | 
|---|---|---|---|---|---|---|
| yyaC | + | 4203924..4204541 | 
| Operon evidence: | Northern blotting; upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | BSORF | 
| Comments: | 
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigF | Promoter | -35:+9 | 4203821..4203864 | CAAAGCATAAAAAATCATACTGCTGGATATACTGTAAACAACCT | 
  Wang S, et al. (2006): AR, Race-PCR | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| AAAAACCATCTTCGTTTGAAAGATGGTTTTTTCATTTATGA >>>>>>>> <<<<<<<<<  | 
  yyaC | 


  |