 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yybNMLKJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yybN | + | 4172138..4172575 | ||||
| yybM | + | 4172689..4173444 | ||||
| yybL | + | 4173434..4174144 | ||||
| yybK | + | 4174141..4174896 | ||||
| yybJ | + | 4174893..4175549 | COG1131 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of readthrough terminators after yybN and yybM. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Rok | Negative | ND | ND | ND |
Albano M, et al. (2005): RG AR DB GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGAATGATAATCTTTTTATAAGATTATCATTTTTATTTATTCTA >>>>>>>>>> <<<<<<<<<< |
yybN |
|