 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yybST-rplI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yybS | - | 4164683..4165612 | COG4241 | |||
| yybT | - | 4162667..4164646 | COG3887 | |||
| rplI | - | 4162221..4162670 | ribosomal protein L9 | COG0359 | rplI-LAB |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the presence of an internal promoter in front of rplI |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAAGAGGCTTGGATTCATCCAAGCCTCTTTTTTTATTCCACG >>>>>>>>>> <<<<<<<<<< |
rplI |
|