 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Regulated Operon: | yycOPQ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Genus clusters |
|---|---|---|---|---|---|---|
| yycO | - | 4137825..4138562 | COG3863 | |||
| yycP | - | 4136651..4137814 | ||||
| yycQ | - | 4136387..4136635 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | The Northern blotting result in BSORF suggests an mRNA transcript of about 2.2 kb, which would correspond to a yycOPQ transcript. The transcription map drawn in BSORF, however, shows a yycOP transcript; no Northern blotting experiment was done with a yycQ probe. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATGAAGAGACTGGTGTGAAGTCTCTTTTTTTGTTGAACC >>>>>> <<<<<< |
yycQ |
|