 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2006
Contact: Kenta Nakai |
| Factor type | Xre |
|---|---|
| SWISS-PROT | Q07683 |
| SubtiList | BG10299 |
| Consensus seq. | TGCGAAAAGCGAATACCTTCTCGCA (plausible) |
| Comment | helix-turn-helix type repressor; regulates the immediately upstream ans operon. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| ansAB | ansA | SigA | Negative | ND | ND | ND |
Sun D, et al. (1993): DB HM Fisher SH & Wray LV Jr (2002): DB DP RG |
| ansR | ansR | None | Negative | ND | ND | ND |
Fisher SH & Wray LV Jr (2002): DB RG |
|