| Factor type | transfer RNA |
|---|---|
| SWISS-PROT | Q04385 |
| SubtiList | BG00054 |
| Consensus seq. | aANNaGGGTGGtACCgCG |
| Comment | Uncharged tRNA-Phe binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| pheST | pheS | SigA | Positive | 2929619..2929657 | None | AGTCTGTCTGAAATAAGGGTGGTACCGCGGCCACAACTC |
Grundy FG & Henkin TM (1993): HM |
|