| Regulated Operon: | ansR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ansR | + | 2456990..2457340 | COG1396K | ansR-BAC |
| Operon evidence: | Northern blotting; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Sun D & Setlow P (1993), BSORF |
| Comments: | Northern blotting results in BSORF suggest that ansR is transcribed in the opposite direction as part of the nudF-yqxK-ansAB and the nudF-yqxK-ansAB-yqkIJK transcripts. The terminator proposed by Sun & Setlow, near the ansR stop codon, is not recognized by mfold and lacks a T-stretch. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AnsR | Negative | ND | ND | ND |
Fisher SH & Wray LV Jr (2002): DB RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAACAGCCATTTCTGTTCCGAAGGCTTTTTTTAGTTTGTC >>>>>>>> <<<<<< |
ansR |


|