Transcription factor: AnsR

Factor type Xre
SubtiList ND
Consensus seq. TGCGAAAAGCGAATACCTTCTCGCA (plausible)
Comment helix-turn-helix type repressor; regulates the immediately upstream ans operon.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ansAB ansA SigA Negative ND ND ND Sun D, et al. (1993): DB HM
Fisher SH & Wray LV Jr (2002): DB DP RG
ansR ansR None Negative ND ND ND Fisher SH & Wray LV Jr (2002): DB RG

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai