| Regulated Operon: | antE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| antE | + | 2602979..2603275 |
| Operon evidence: | transcription terminator probe vector |
|---|---|
| Reference: | Wang LF, et al. (1999) |
| Comments: | The antE coding region overlaps the dnaG gene located on the opposite strand; the terminator is located between dnaG and yqxD. The stem-loop contains a sequence of three mismatched basepairs. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -38:+5 | 2602931..2602973 | CTTTTGTATTTATTAACAAATGATGGTAAAATTTCTTCAGGAG |
Wang LF, et al. (1999): S1 |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CTTTAGTGCAAAATCCCTTCATCGTTCGACAGGATTTTTTGCAGCAGTG >>>>>>> <<<<<<< |
antE |


|