Transcription factor: SigA

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TTGACA(-35)-N14-tgnTATAAT(-10)
Comment RNA polymerase major Sigma-43 factor (Sigma A). Essential gene.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
abnA abnA 2950133..2950187 -48:+7 CTATTTTTTTGTCTGTACAAATTACAGCATAGTGACTACAATAAAGGGGATACCG Raposo MP, et al. (2004): RG PE
abrB abrB 45214..45269 -48:+8 TCTTACAATCAATAGTAAACAAAATGATTGACGATTATTGGAAACCTTGTTATGCT Perego M, et al. (1988): PE NB RG
abrB abrB 45200..45257 -50:+8 TAGTAAACAAAATGATTGACGATTATTGGAAACCTTGTTATGCTATGAAGGTAAGGAT Perego M, et al. (1988): PE NB RG, binding site mutation
ackA ackA 3016385..3016434 -44:+6 CAAGTTGACTTGAAAAGCCGACATGACAATGTTTAAATGGAAAAGTCAGA Grundy FJ, et al. (1993): PE
acsA acsA 3039944..3040013 -52:+18 GGTTTATATTTTAAAAATTGAGAAGAATATGAATATATACTATAATAATTGTGACAACTTCAGCAAAGGG Grundy FJ, et al. (1994): PE
acuABC acuA 3040002..3040068 -49:+18 AAAATATAAACCATGTTGAAAACGCTTTATAATTTGGTATTCTTAAAGAAGGCATGTATTTTTGATA Grundy FJ, et al. (1994): PE
adaAB adaA 203559..203625 -49:+18 ACATTCTAACCACCTTATTTTTTTCTATTTATGAGGTTATAGTGTAGTTATCAAGAATGCTAAACGG Morohoshi F, et al. (1993): PE
addBA addB 1136244..1136311 -48:+20 ACCAATAGATCAGATTGGTCATTTTCGTCAACATTCGATAAAATATAGAGAGATAAAAAGAGAGGGGT Haijema BJ, et al. (1995): PE
ahpCF ahpC 4118845..4118891 -41:+6 TATGGCTTGACAAAAAATATATATTAATTAATAATTCATATATAATT Antelmann H, et al. (1996): PE HM
ald ald 3278250..3278317 -50:+18 TTTCTTAATCAAACAAAGAATTTTCCAAAATATCAAGCTACACTAAAAATATCACATATACAGGAGGA Siranosian KJ, et al. (1993): PE
alkA alkA 203490..203554 -47:+18 GCAAGATAACAAAATGAGTAAAGATGATTATGTGATAAACTAATTTCAACCAGCGTGAGTTTTCT Morohoshi F, et al. (1993): PE, dinucleotide primer experiment
alsSD alsS 3711378..3711440 -46:+17 GAATCGATATTGGAGGTCAATTTCCAAAGAGTGTATAGTGAAACTTATCACAAGATATTTAAA Renna MC, et al. (1993): PE
amhX amhX 325250..325308 -42:+17 TTAATTATTCTGAATAGTAGCAATATGTGCTATATTATATACAGCCTATCTTCCTGTTT Kempf B, et al. (1996): PE
amyE amyE 327447..327513 -50:+17 TTCACTCTGCCAAGTTGTTTTGATAGAGTGATTGTGATAATTTTAAATGTAAGCGTTAACAAAATTC Nicholson WL, et al. (1987): S1
Chambliss GH, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 p.85-89: S1
ansAB ansA 2456857..2456920 -45:+19 ATAATAATGTCTTGCGTATTTTATTTTCCGTGTCTATAATTGCATTAAAAGTATGCGAAAAGCG Sun DX, et al. (1991): PE
antE antE 2602931..2602973 -38:+5 CTTTTGTATTTATTAACAAATGATGGTAAAATTTCTTCAGGAG Wang LF, et al. (1999): S1
aprE aprE 1105609..1105685 -59:+18 AAAATCATCTCAAAAAAATGGGTCTACTAAAATATTATTCCATCTATTACAATAAATTCACAGAATAGTCTTTTAAG Henner DJ, et al. (1988): PE NB DP
Ferrari E, et al. (1988): RG PE DP NB
Park SS, et al. (1989): DP S1, in-vitro transcription assay
aprX aprX 1862727..1862775 -37:+12 ACTTACCAAACCTATCATCTGTTCATAGAGTATACAGAGAACCTTATAA Valbuzzi A, et al. (1999): PE DP RG
araABDLMNPQ-abfA araA 2948963..2949012 -50:+10 AAAGATTGACAGTATAATAGTCAATTACTATAATAAAATTGTTCGTACAA Sa Nogueira I & Ramos SS (1997): PE HM
araE araE 3485565..3485608 -39:+5 AACATTGACAGAAAATGCAAACAAGATTATTCTATATTTGTACG Sa Nogueira I & Ramos SS (1997): PE
araR araR 3485603..3485648 -40:+6 AATGTTTTCTTACAAAGAACGCTGTGATATACTGAAATTTGTCCGT Sa Nogueira I & Ramos SS (1997): PE
arfM arfM 3830636..3830694 -52:+7 AGGCTGTGAAATACATCACTGCTGTACAGGCTCAGTCGAGCTACACTAAAGCTATCCTT Cruz Ramos H, et al. (1995): PE
Marino M, et al. (2001): PE
argCJBD-carAB-argF argC 1194958..1195018 -44:+17 AATATACGATTGAATTAATTTTTATTCATGTTATAATGTTAAATAATTTCACAAAGACCAA O'Reilly M, et al. (1994): PE
Smith MC, et al. (1986): S1, mung-bean nuclease mapping
arsR-yqcK-arsBC arsR 2657658..2657717 -50:+10 ATTGATTTATTTGCTTGCATTAATTTAAAAATCATGAGTATAATAAATACATCAAAAAAA Sato T & Kobayashi Y (1998): PE HM
spoVFAB-asd-dapG-dapA asd 1745895..1745953 -41:+18 AATTCGGTCATCACCCGCATATTCTATGGTAAAATAAAACGTAAAATCATAGTCAAATC Chen NY, et al. (1993): PE
bglC bglC 1940523..1940589 -49:+18 AGAAATTAGGTTGATAGACAATCATGAGAAAGATTTTTACAATGAGTTCGTGCTCATAAGAAGTGTA Robson LM, et al. (1987): S1
bglPH-yxiE bglP 4035814..4035863 -47:+3 AAAATGAAAGCGTTGACATCTCACGAATCTAGTGCTAAAGTATACCTACA Le Coq D, et al. (1995): PE
licT-bglS bglS 4013730..4013782 -48:+5 TTTCCCTGATGATATTGACCTAGTACAAAAAGAATGTACAATCAAGATATAGT Schnetz K, et al. (1996): PE
blt-bltD blt 2716863..2716907 -41:+4 CTCCTTGACTATACGGTAACCATATACCTTATGATTTGATTGTAC Baranova NN, et al. (1999): RO
bmrU-bmr-bmrR bmr 2494587..2494631 -41:+4 TCCGTTGACTCTCCCCTAGGAGGAGGTCTTACAGTATAAGGGATA Baranova NN, et al. (1999): RO
bsrB bsrB 2096106..2096154 -43:+6 CTGACCTCTTGATTAAAAGCGCCTGATGGTGTACTATATTAAAGAAGCT Ando Y, et al. (2002): NB PE
ccdA-yneIJ ccdA 1923086..1923134 -44:+5 TCAAATGAGAAGGAGTATAATGTCTCAATGTCAAATTAAATTATATAAG Schiott T & Hederstedt L (2000): PE NB
ykuJK-ykzF-ykuL-ccpC ccpC 1485969..1486022 -44:+10 GGGCTTGAATAAGAAACTAAGATTTTATTAGAATGGGAGATAAGAAAAACTTAT Kim HJ, et al. (2002): PE
cdd-era cdd 2611373..2611426 -48:+6 TTTTTAGAAATGGGCGTGAAAAAAAGCGCGCGATTATGTAAAATATAAAGTGAT Wang PZ & Doi RH (1984): S1 RO
Song BH & Neuhard J (1989): HM
cggR-gapA-pgk-tpiA-pgm-eno cggR 3483857..3483912 -42:+14 CTTAACAGTTGAATAAACAATTCCACCCTGTTAAAATAATTAAAGAAAGCAGAAAT Ludwig H, et al. (2001): PE
citA citA 1020985..1021049 -47:+18 CCCTTTAAAATATTGATTATTTTTTAAATATTATATTTACTATAATAACAGAAAAGGATAGGGGG Jin S, et al. (1994): PE
citB citB 1926564..1926629 -48:+18 AAAAACATTGATATTTACTTATGTATGATTTTGTTTTAATATGAAATTGTGAGAAAATTGTGATGG Whipple FW, et al. (1992): RO
citG citG 3390706..3390762 -50:+7 AAACCTTAGTAGAGGTTATCTTTTCCTGTTAAAAAAATGATATACTGTGTTAGAGTA Feavers IM, et al. (1988): S1
Tatti KM, et al. (1990): PE
Price VA, et al. (1990): DB
citG citG 3390692..3390742 -44:+7 TTTTCCTGTTAAAAAAATGATATACTGTGTTAGAGTATTTCATGGAGTAAG Feavers IM, et al. (1988): S1
Tatti KM, et al. (1990): PE
Price VA, et al. (1990): DB
citM-yflN citM 834264..834323 -48:+12 ACAAAAAAACCAAATTATTTACTTGCGGTTGGTTTTCCCATACGATGGCAAAAAGGCAAG Yamamoto H, et al. (2000): PE
citR citR 1020983..1021047 -46:+19 CCCTATCCTTTTCTGTTATTATAGTAAATATAATATTTAAAAAATAATCAATATTTTAAAGGGAA Jin S, et al. (1994): PE
citZ-icd-mdh citZ 2982446..2982511 -48:+18 TATAGGTAAACATTTAACAAATGTCTGATTATTGTTTATAATGAGAATAGGCTTAAACTTAAATAA Jin S, et al. (1994): PE
clpE clpE 1437923..1437966 -39:+5 AGACTTGAAAGTCAAAGATAGTCAGAGTATACTATTAATCAAAG Derre I, et al. (1999): PE
clpE clpE 1437804..1437846 -38:+5 TGGTTTGAATGCCGTTAAGTTTGCCGTATACTAATAGTCAAAG Derre I, et al. (1999): PE
clpP clpP 3546151..3546220 -50:+20 AGGCCAGCTTTTTGTTTGACCTTTATTGACCAAAAATGTATCATGTAACTACATACTTACCTAAAAGGTG Gerth U, et al. (1998): PE HM
clpX clpX 2886119..2886168 -46:+4 AACACATTGTTACCGTCTTTTTGGAAAGTATGGTAAAATGCAATACATAC Gerth U, et al. (1998): PE
codV-clpQY-codY codV 1687120..1687168 -43:+6 GTATTGATTGCAACCTGAGCGCGATTTGTGATACCATTTAAAAGCCCTT Slack FJ, et al. (1995): PE
comA-yuxO comA 3253456..3253517 -43:+19 CGGAAACGACTTGGCACAGGCCAAGTCTTTTTTATAAAATGGAAAAGAGTGAGTAAAAGGGA Weinrauch Y, et al. (1989): S1
comC comC 2865185..2865253 -53:+16 TTGAATATTCCCAATTGGAGCTCAGGATGTCCATTTTGCTACAATCCATACCAGAACTCAATGAGTAAA Mohan S, et al. (1990): PE
comEABC comEA 2642015..2642083 -50:+19 ATGCTTTTTTATGCTTTTGCAGTACAGACGAACGTATGACATACTCGTCTACACATGAAACTGCTTTTT Hahn J, et al. (1993): PE S1
comFABC-yvyF-flgM-yvyG-flgKL comFA 3643557..3643621 -46:+19 TATTTTAATAGTTGGACAGAAAATATTCATTCAGGCATACTGTTTCGAAAGGAGGCGTGCTATGT Londono-Vallejo JA, et al. (1993): PE S1
comGABCDEFG-yqzE comGA 2560080..2560145 -49:+17 ACGTTTTCCCTGTTTGATTACCTTTTCTTCTTTTTCTACAATATGCGTTGAAAGGAGAGGGAATCA Albano M, et al. (1989): PE
comK comK 1117024..1117092 -49:+20 AAATGTTAAAAAAACCTGTCGTTTTACAAAAACAGATGATAGATTATTAGTATAAATTTTGCAGAAAAA Van Sinderen D, et al. (1994): PE
comQX comQ 3256950..3257018 -51:+18 AAAAACGAAAAACCTGCTGTCCTTTAAATGTCCCATTTAGTAAAATGGAATGGGAGGGGGGAAGTCGTT Weinrauch Y, et al. (1991): PE
csbA csbA 3615371..3615414 -40:+4 ACGATTGTCCGATTCTTCATTTTTTACTATAATCAGATCAGATG Boylan SA, et al. (1991): PE DB RG
cspB cspB 984567..984634 -50:+18 AATTTCAATAAGCAGTTGTTTTTTCTGAAGATTACTGGTAGAGTAAAGGTAATTATTTTTGTTCGAAC Willimsky G, et al. (1992): PE
cssRS cssR 3385562..3385633 -63:+9 TCATCCTACATCTTCCTCGCTCTTTTTCTCTTCCTTTCTTCCCTTAACCATATCATAAACAAACATTGTGGG Darmon E, et al. (2002): PE
cssRS cssR 3385660..3385716 -46:+11 TATGAAAATTGCCTGCCGTATGTTAAAACTAGTTTATAATGACGTTGAAAGGATGTG Darmon E, et al. (2002): PE
ctaA ctaA 1558988..1559035 -39:+9 GGAATTGCCACAAAACACATATTCGCTTACACTTGGAACGTATATAAA Paul S, et al. (2001): PE, in-vitro transcription assay
ctsR-mcsAB-clpC-radA-yacK ctsR 101366..101417 -43:+9 CGAGAAAGTTGAAAATTCTCGAGAAACGGCTTATAGTAAGATTAAAGTCAAA Kruger E, et al. (1996): NB PE
cydABCD cydA 3979382..3979429 -39:+9 GGCTTTATTTTTGAAATGAATCGTTGTAAAGTACTTAATATGAACCAG Winstedt L, et al. (1998): PE RG NB
cysHP-sat-cysC-ylnDEF cysH 1630064..1630118 -39:+16 AGTCGGGTTGACTTATGTTAGAATTGTGCTAAAATTTACTACAAATCTAAAAACT Mansilla MC, et al. (2000): NB DP
cysK cysK 81690..81738 -41:+8 AAGTGATTGACAAAAAATTTTGAAATTGATAGATTATATACATAATACC Van der Ploeg JR, et al. (2001): PE
dctSRP dctP 500081..500130 -43:+7 TCATAAACTTCCCCAGACTGTATGAAAACGCTATCATTCTAGTAAGAAAG Asai K, et al. (2000): PE
degSU degU 3645392..3645442 -44:+7 GACAATAGATTCGAAAATAGGTCTTGGGACATTTATTATGATTAAGGTTCC Yasumura A, et al. (2008): PE
degSU degU 3645307..3645356 -45:+5 AAAAGGCATATTGACCGAATGCTAGAGTATATAGAACAATAATACAAGGA Yasumura A, et al. (2008): PE
degQ degQ 3257288..3257355 -48:+20 TTTGCATACTTTTCGGTGAAAAATGAGCCGAAAGCAGACACACTATTAGTAACAGATCAAATACCTAG Yang M, et al. (1986): S1
degSU degS 3646643..3646709 -52:+15 ATTCGTACAGTCTTTAGAATTTTTGTGCGTATTTTGGTATCATAAAGAGTAGATAGTATATAAAAAT Msadek T, et al. (1990): PE
des des 2089325..2089372 -43:+5 GTGTGCTACTACAAAAGACTTCTCTCATTAGCGTATACTGAACCGAGA Aguilar PS, et al. (1999): PE HM
dhbACEBF dhbA 3292405..3292444 -39:+1 ATATTTGACTGTCACATGACATTTGGATATGATTATTTTT Rowland BM & Taber HW (1996): PE
murE-mraY-murD-spoVE-murG-murB-divIB-ylxWX-sbp divIB 1593567..1593631 -50:+15 ATCGCTGATTCAAGTTCTGACTGAAGCTGTTCATATGATATACTGTAAGCAAACGACAAACGGCA Harry EJ, et al. (1994): PE DB SDM RG DP NB
dnaAN dnaA 110..174 -47:+18 TTGTGACAACCATTGCAAGCTCTCGTTTATTTTGGTATTATATTTGTGTTTTAACTCTTGATTAC Moriya S, et al. (1988): S1
Ogasawara N, et al. (1985): S1
lepA-hemN-hrcA-grpE-dnaKJ-yqeTUV dnaJ 2625933..2625985 None AAAGGAATTGAAAAATCATAATTCAAAATGATACAATCTAATTTATGTGAGAA Homuth G, et al. (1997): NB
dppABCDE dppA 1360319..1360383 -46:+19 TTCCCAGTTATATTGCATTTTTCCTCTTTTTTTAATATAATTTGTTAGAATATTCATAATTTAGT Slack FJ, et al. (1991): PE
deoR-dra-nupC-pdp dra 4052293..4052362 -58:+12 ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAAAAGTCGGTTATGCTAAAAAATATCTTAACAA Saxild HH, et al. (1996): PE
drm-punA drm 2448467..2448525 -42:+17 AATACATTGTCAACGGGAATGAAAACGGTTTATACTTGAGTTGTCAGACCTCTTAGCGA Schuch R, et al. (1999): PE
drm-punA drm 2448449..2448495 -41:+6 TATACTTGAGTTGTCAGACCTCTTAGCGATACAATAGACGTATAGAA Schuch R, et al. (1999): PE
fabHAF fabHA 1208114..1208167 -40:+14 AATATATTGCCATGTGAAAAAAAATAGGATAGAATTAGTACCTGATACTAATAA Schujman GE, et al. (2003): PE
yfhQ-fabL-sspE fabL 936596..936643 -43:+5 ACCTGGTATGGAATATTTCAGTGTTTTTCGGTAAAGTAAAACAAGTGT Yamamoto H, et al. (1999): NB PE
yfhQ-fabL-sspE fabL 936868..936912 -39:+6 TTGATTGGCCTTCTTCGTTCAAATAAGGCATAATTTGCTGAAAGG Yamamoto H, et al. (1999): NB PE
fapR-plsX-fabDG ylpC 1661892..1661954 -45:+18 ATCGTTGCATTCCAATCTATGAAATTATATACTACTATTAGTACCTAGTCTTAATTGTCCGGA Schujman GE, et al. (2006): PE
fbp fbp 4127978..4128028 -46:+5 GTTTTAATTGTCTCTAAAAGCAGTTATGCGGTACTATCATATAAAGGTCCA Fujita Y, et al. (1998): PE
feuABC-ybbA feuA 183354..183406 -45:+8 GGAATTTGTCCATGGTGTTATATCTGTTCATTCTCTATAATTCCAATTGATAA Fuangthong M & Helmann JD (2003): PE
feuABC-ybbA feuA 183349..183408 -50:+10 CAGGAATTTGTCCATGGTGTTATATCTGTTCATTCTCTATAATTCCAATTGATAATAGTT Gaballa A, et al. (2007): PE
fla-che flgB 1691170..1691216 -44:+3 CGAACTTCATAGACTTTATGCCTGTTATTTCTTACAATAAGCATATA West JT, et al. (2000): PE DP, Western blot
Estacio W, et al. (1998): PE
ftsAZ ftsA 1596400..1596464 -47:+18 AAGCCACATTCATTGTATTGTTGTTCCGCAAATAATAGAATAGAAATGATCGAAATGTGAGGAGG Gonzy-Treboul G, et al. (1992): PE RG
Fukuchi K, et al. (2000): DP RG
ftsAZ ftsA 1596140..1596205 -48:+18 CAATAAGTTTAGCTTTTCTGGGAGTCCATCTTGGTGTAGACTTGTATTTAGCAGGTATATTCGCAT Gonzy-Treboul G, et al. (1992): PE RG
Fukuchi K, et al. (2000): DP RG
ftsH ftsH 76912..76960 -42:+7 ATTGTTTGTATTGGAATGATTTTCTATGGTACTATTGAACATAGTTGTG Deuerling E, et al. (1995): PE
fur fur 2450309..2450356 -39:+9 TATAGTTGGAACTCTGCGCGTATTTTGTTATAATGAGTCATGGAATGC Fuangthong M, et al. (2002): PE HM
gapB-speD gapB 2968091..2968148 -48:+10 TTATCAATATGTACTGGCGAATTTGTTTTAATGTGTTATACTAATTTTAGATAGTAAC Servant P, et al. (2005): PE
gabP gabP 686600..686648 -40:+9 AATTTTCGACAAACTGTATATTTATGATAGAGTTTCAATTATCATAATA Ferson AE, et al. (1996): PE HM
gabP gabP 686589..686638 -42:+8 AAACTGTATATTTATGATAGAGTTTCAATTATCATAATATTCAGTAATGA Ferson AE, et al. (1996): PE HM
gabR gabR 441505..441555 -45:+6 TCGGTATTTTCTTATCATTCTGACTTCTCTTTGGTATGATGAAAAGTACCA Belitsky BR & Sonenshein AL (2002): PE
gabTD gabT 441504..441560 -39:+18 TTGGTACTTTTCATCATACCAAAGAGAAGTCAGAATGATAAGAAAATACCGACAGGG Belitsky BR & Sonenshein AL (2002): PE
galE galE 3990987..3991035 -41:+8 AAATGGATGTGGACCGGTTCTAAACACTATATAATGAAAACAGGTCATT Krispin O, et al. (1998): PE
gcaD-prs-ctc gcaD 56276..56340 -48:+17 CATGAAGTCTCCTTGAAATCAGAAGATATTTAGGATATATTTTTCTATGGATAAAAGGGATATTG Moran CP Jr, et al. (1982): RO, dinucleotide priming
Henkin TM, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 p.63-67: SDM RG RO
Whipple FW, et al. (1992): RO
ggaAB ggaA 3672468..3672552 -59:+26 TGATGATTTACATTTTTAAAGAGCCTTAACTTTTATAGGAACATATGCTATTATTGTTTATTATTAATGGAACGTAAAAAATATG Freymond P-Ph, et al. (2006): PE
glnRA glnR 1877886..1877951 -49:+17 TCCTTACATCGTATTGACACATAATATAACATCACCTATAATGAAACTAAGTTAAGAAAAGGAGGA Strauch MA, et al. (1988): RO
glpD glpD 1004814..1004877 -46:+18 GCAGCTATGGCTTTTAAATAAAGTAATACTATGGTATAATGGTTACAAGTTAATAAGAACGGTC Holmberg C & Rutberg B (1991): PE
glpFK glpF 1002307..1002371 -47:+18 GACGGAAAGTGATTGACACCGCTTTCATGCACTGATACAATTGCACTAGGTTAATACATTGTGAT Holmberg C, et al. (1990): PE
glpTQ glpQ 233919..233974 -46:+10 AATAGTTTTCCAACACGCCGTTTACATCCGTTTTTTATTATGAAAGACAGGTAGTG Antelmann H, et al. (2000): NB PE
glpTQ glpT 235466..235528 -45:+18 GAAAATTACCCGTTTACATTCGCTCCGGACTATGATAATTTAAGAAAGCGCTATCATGATAAG Nilsson RP, et al. (1994): S1
ybgJ-ybgH ybgJ 265250..265324 -55:+20 AAAATGTTTTTGTCGTATTTTGTATGATTCTGTAGTCTCCATTATACAGTAATTATACCTTCCGCTATTATGAAA Satomura T, et al. (2005): PE
gltAB gltA 2014671..2014735 -47:+18 CTAAATTATATATTGTTTATATCGTTTTGAAAACCTACAATGATTATAGAGTTGTTAGATTTTAT Bohannon DE, et al. (1989): S1
Belitsky BR & Sonenshein AL (1997): PE
gltR gltR 2725741..2725799 -50:+9 TCTAAGCTTTAGTTTACATGAAGCTCTGCTATCATATATAATTCAAAATTAAGATGGAA Belitsky BR & Sonenshein AL (1997): PE
gltC gltC 2014693..2014755 -46:+17 TCATTGTAGGTTTTCAAAACGATATAAACAATATATAATTTAGATCAAAAGAATCTCAAAATG Bohannon DE, et al. (1989): S1
gltX-cysES-yazC-yacOP gltX 110951..111013 -52:+11 GGCTAACTTGTTTTGATGCCGGGTCTATTTGGTGGTAGAATAGATTCATACATTTTTGCCTGA Gagnon Y, et al. (1994): S1
glyA glyA 3790476..3790521 -41:+5 ATCTTTTACATCGGCCTTAAAAACCATGTACAATAGTGATGGTAAA Saxild HH, et al. (2001): PE RG
gntRKPZ gntR 4113336..4113398 -47:+16 ATGAAAGTGTTTGCATAAAAGAAATATTCACGTTATCATACTTGTATACAAGTATACTCCTTG Fujita Y, et al. (1986): S1
gntRKPZ gntZ 4117012..4117079 -42:+26 CGTTGCTGGACTGGGATTCATTTTATTGTTAAGTTTAGTTGTATGAAATTAAGAAGGAGCTGTAACAC Fujita Y, et al. (1986): S1
groESL groES 649794..649854 -43:+18 CTTATCACTTGAAATTGGAAGGGAGATTCTTTATTATAAGAATTGTGTTAGCACTCTTTAG Li M, et al. (1992): PE
gtaB gtaB 3665509..3665555 -40:+7 AAAGCTTGTTTAAAAATGGTTTATCCGATATCATAAAAATGTGTAAA Varon D, et al. (1993): PE
guaA guaA 692563..692626 -46:+18 AGAAGATGGTCTTGACCGCTTATCGACGTGTTGTTAGAATTAGTGAATATTATCGGAGTCTGGG Mantsala P, et al. (1992): PE
guaD guaD 1383164..1383212 -41:+8 TTAAGAATGTTCTTTGCATTCTTTTCGGCTATACTAATAACACTCTATT Nygaaard P, et al. (2000): PE HM
gudB gudB 2403390..2403439 -43:+7 TTTATTCTATGCACAGATCATATGAAGGTGTATACTATTCTCTGAAAGGG Belitsky BR & Sonenshein AL (1998): PE
gutBP gutB 667356..667419 -46:+18 GCAGGAAAGGCTGTTGAACGTGTTAAAAAGCAGATAAAATGGGGGCAGTAACAGAGAAAACAAA Ye R, et al. (1994): PE SDM
gyrA gyrA 6871..6934 -45:+19 AGCAATTTAATGTGTATAATCATAAGTTTATTGATATAATGGAGAATAGTGAAATCGTATTGAA Ogasawara N, et al. (1985): S1
hbs hbs 2385985..2386042 -40:+18 AATGCTTGATATGGCTTTTTATATGTGTTACTCTACATACAGAAATTCTTCACTTTGT Micka B, et al. (1991): PE NB
Micka B & Marahiel MA (1992): PE NB
Fernandez S & Alonso JC (1999): RG PE
hbs hbs 2386024..2386076 -42:+11 TAAATCCTTGACGAGCAAGGGATTGACGCTTTAAAATGCTTGATATGGCTTTT Fernandez S & Alonso JC (1999): RG PE
hemAXCDBL hemA 2879182..2879249 None TTTTAAAATCTGTTCACATTTTGTGAAAGAAACTATGTTATAATTATTATAAATAATGAGTTCTATGT Hansson M, et al. (1991): S1
hemZ hemZ 1057609..1057654 -40:+6 CCGGATTGATTTTAGCAGTTTATTTCTGTACACTAAAGAAAGTTTT Homuth G, et al. (1999): PE NB
lepA-hemN-hrcA-grpE-dnaKJ-yqeTUV hrcA 2629665..2629731 -49:+18 TGGGTGAGTTATAATTGACATTTTTCTTGTGGTTTGATACTTTTGTTATAGAATTAGCACTCGCTTA Wetzstein M, et al. (1992): PE NB
Homuth G, et al. (1997): NB
htpG htpG 4091342..4091387 -41:+5 ATCTAATTGACAATTGTCATCTTATGTGATAAATAGATGCTGAAAA Schulz A, et al. (1997): PE NB
htrA htrA 1359339..1359389 -44:+7 TAATCTTTTCATTTTTATCCCACAGTTTTTGTTTATGATAAACTCAAGTCA Noone D, et al. (2000): PE RG
hut hutP 4041405..4041467 -46:+17 AAAAAACCTTTTGACTTCTGCTGCTGAACCAATTAATATAATACTCAGTTAATAGTTATCAGA Wray LV Jr, et al. (1994): PE
citZ-icd-mdh icd 2981052..2981114 -45:+18 GCCTCTTGTTCAGACATCAAAATTGGGTTACACTTTAAATTGAATGTTAGGAAAAATCATTTT Jin S, et al. (1994): PE
ilvBHC-leuABCD ilvB 2897436..2897499 -45:+19 AAAAAATGCTGTTGACACTGCGTCCAAAGCGGCGTAATATGAGTTCAACAAAAGATAAATGCAA Grandoni JA, et al. (1992): PE SDM RG
infC-rpmI-rplT-ysdA infC 2953549..2953587 -37:+2 CTTGACTAAAGATCCGGTATTGTGTAGAATAGTTATTGA Choonee N, et al. (2007): PE
iolRS iolR 4084731..4084774 -39:+5 CTATTGATTAACTTTTGGTTTTTATTATATATTTATGTTACGTA Yoshida KI, et al. (1997): PE
ispA ispA 1387019..1387075 -47:+10 CAAATGGCTCTGTCCGAGCGCTTGCTTTTTTCATATAATATGAGGCAACACCCTTGA Koide Y, et al. (1986): S1
ydjK ydjK 676113..676158 -41:+5 TTTATATTGACTGAAAGCGTTTTTATAATTATGATAATATCAGATA Yoshida K, et al. (2002): NB PE FT
kdgRKAT kdgR 2325678..2325725 -43:+5 AAAAAACTCTTCCCAAATTTTAAAATTATGGTATTCTTTTGTTGTAAC Pujic P, et al. (1998): PE
kinB-kapB kinB 3230002..3230045 -37:+7 ATATTTTACTTCTAATATTTAGTGTTATAATAGATTCATATTTT Trach KA & Hoch JA (1993): PE
kinC kinC 1518262..1518325 -46:+18 TACATATTTTACTCAATTATTTGTCGAAGAATGGTACAATAAGTAGAGAAACACAAGCGGCAGG LeDeaux JR, et al. (1995): PE
Kobayashi K, et al. (1995): PE
ldh-lctP ldh 329676..329723 -39:+9 TCTCTTGCAAAAGTTTGTGAAGTGTTGCACAATATAAATGTGAAATAC Cruz Ramos H, e al. (2000): PE
lepA-hemN-hrcA-grpE-dnaKJ-yqeTUV lepA 2632774..2632843 -58:+12 ACTTTTCTCTTTCTTGTTTTACATTGAATCTTTACAATCCTATTGATATAATCTAAGCTAGTGTATTTTG Hippler B, et al. (1997): PE
licBCAH licB 3961916..3961961 -40:+6 CTGAGTGTTTATGAAAGCGATTTCATAATATGATGATAGCAACAGC Tobisch S, et al. (1997): PE NB
licR licR 3964002..3964043 -38:+4 GTTCATTGACTTGCCATTCTCTCCATTATAGAATTTATATAC Tobisch S, et al. (1997): PE NB
lmrAB lmrA 290733..290788 -48:+8 CAATGAATTTTTCTTGACAATTGATGATTGAATCAAGATAATAGACCAGTCACTAT Kumano M, et al. (2003): PE
lonA-ysxC lonA 2882872..2882932 -44:+17 TCTTTTCCTTTTTCATATCAGAAAGAAAGGGTATACTACGAGGAGACTGTTTTATAGAAAA Riethdorf S, et al. (1994): PE
lonA-ysxC lonA 2882800..2882863 -47:+17 TGCCGTTTATTGTACAAGGATGAAAAAGTTGTATTATAATGGTTCATACTAAAGTCACGGAGGT Riethdorf S, et al. (1994): PE
lrpC lrpC 475990..476054 -43:+22 GAACTGTACTTGTCATTTACAAAAATACCCGAGATAATGTGTACAAAATCAAAAAAGAAGGATGT Beloin C, et al. (2000): PE
lysC lysC 2911061..2911125 -48:+17 GCAAAAATAATGTTGTCCTTTTAAATAAGATCTGATAAAATGTGAACTAATTTCATAGTTAGATC Chen NY, et al. (1987): PE
Chen NY, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 p.69-74: PE
lytABC lytA 3663124..3663169 -39:+7 AGTTTCATTGTTTCTTAATTTTTCTTTAAAATATAAAATAGGTTGA Lazarevic V, et al. (1992): PE
lytR lytR 3663218..3663261 -39:+5 AGAGTTGTATTTATTGGAAATTTAACTCATAATGAAAGTAATTT Lazarevic V, et al. (1992): PE
Huang X & Helmann JD (1998): RG PE RO
maeN maeN 3244703..3244754 -40:+12 TTAAAAAAATATGAAGTGTTAACGCTTTCTTGTAGACTGTAACAAACAATAC Tanaka K, et al. (2003): PE
malA-yfiA-malP malA 889954..890000 -42:+5 AACGTGTTACGGGACGAGCTATCTCATGGTATAAATGGAATTGTAAA Yamamoto H, et al. (2001): PE NB RG
mecA mecA 1228967..1229031 -48:+17 AAGGTTAAGATGTGGACGGAATGGGTAAAGTGTAGTAAAGTACAATTAATCGGGAGCTTAGATGT Kong L, et al. (1993): PE
med-comZ med 1206498..1206548 -40:+11 AGTGGAAAAGACAATTTTCATCAATTTTCGACAAATATTAAGAAAAACCTT Ogura M, et al. (1997): PE HM
med-comZ med 1206498..1206548 -46:+5 AGTGGAAAAGACAATTTTCATCAATTTTCGACAAATATTAAGAAAAACCTT Ogura M, et al. (1997): PE HM
menBEC menB 3149688..3149751 -47:+17 ACTCATTCACATAGAGAATAAAAGGAGGTCATCATATGGCTGAATGGAAAACAAAACGGACATA Driscoll JR, et al. (1992): PE
menBEC menE 3148790..3148855 -50:+16 GCTGTTTTCTTTTCAATACAGACATTTTACCTCGGAGATGATGACATGCTGACAGAACAGCCCAAC Driscoll JR, et al. (1992): PE
menBEC menF 3153795..3153857 -45:+18 GCTTTGTTTCTTTTTCATTTCTGAAATTAGGTTTATAATAGGTAAGGCAGGCCATTTGGACTG Qin X, et al. (1996): PE
mmsA-iolBCDEF-idh-iolHI-fbaB mmsA 4084567..4084613 -39:+8 ATGATTGACTTATGGGTATTATGCGATTAGAATATAACCAAGAAATG Yoshida KI, et al. (1997): PE
mrgA mrgA 3383477..3383540 -60:+4 CTAAATTATAATTATTATAATTTAGTATTGATTTTTATTTAGTATATGATATAATTAAGTCAAC Fuangthong M & Helmann JD (2003): PE
mta mta 3764918..3764962 -41:+4 GGGATTGACCCTAACGTTGCGTGATTGTTTACGATAAAAAAGAGG Baranova NN, et al. (1999): RO
mtrAB mtrA 2385376..2385430 None CATTCACTTTGCTTTTAGCGGGGCATATGTGCTAGAATCGAAATTAAATGTATTC Gollnick P, et al. (1990): HM SDS-PAGE RG
nadBCA nadB 2849482..2849544 -47:+16 ATAAAAAACTCTTGAGTTTATTTTATCCTTGTGTAAATATAGGTGTCAAGACAGGTGTAAACA Sun D & Setlow P (1993): PE
nadE nadE 338161..338206 -43:+3 TCTCTTGTTCACAGTGAATGAAGACCTGTGCTATATTTAATAGGGA Antelmann H, et al. (1997): PE
narGHJI narG 3829964..3830030 -52:+15 AGTGTGTGACATAGTTCACAAGGAAACACGCTGTCTCTGTTTATAGTGAACTTAGCATCACCTGACT Cruz Ramos H, et al. (1995): PE
Reents H, et al. (2006): PE
nasA nasA 362854..362914 -43:+18 CACATGTCTTTTCCAGAAAATAATGGTCCTATATCCTTGATTCAGAAAATGTAAAATAATG Nakano MM, et al. (1995): PE
nasBCDEF nasB 362781..362846 -49:+17 TTGTGACACGTTTAATGCGTTAACAATGCATTGTGACATAATTTTTAATAGGAGAAAACTTACGAG Nakano MM, et al. (1995): PE
nfrA-ywcH nfrA 3912242..3912286 -41:+4 TTTCACTTTTGAGATCACTTTTTTTCGGATATGATAAAAAGTGAT Moch C, et al. (2000): PE
nifS-yrxA nifS 2849485..2849549 -47:+18 TTACACCTGTCTTGACACCTATATTTACACAAGGATAAAATAAACTCAAGAGTTTTTTATGGAGA Sun D & Setlow P (1993): PE
nrgAB nrgA 3756698..3756762 -47:+18 TCTTACATGAAAATGTTTTATCATTCTTTTTTCTCTATAATGAAGAAATATAATAATTGCTTTTT Wray LV Jr, et al. (1994): PE
ylxS-nusA-ylxRQ-infB-ylxP-rbfA nusA 1731553..1731616 -46:+18 GCGTATATCCATTTGCAATAAAAATATGGTTATGGTATAGTTTTATTGGAAATGCTAACGATTA Shazand K, et al. (1993): PE
odhAB odhA 2111707..2111770 -48:+16 TTTTTTACTATTTTGTGAACAATCAAGGTAGAATCAAATTGCAAACAGTGGTAAAATATCGTTG Resnekov O, et al. (1992): PE
kinE-ogt ogt 1421278..1421336 -48:+11 GGGGAACTGGACTTGGGCTTATGGTAAGCTATAAAATTATTGAAGAACATCAAGGCGAG Morohoshi F, et al. (1989): PE
opuAABC opuAA 320909..320956 -43:+5 GATGTTTATAAAGAAATGGTACAGAATAAAAGAGAATATGCTGTTTGT Kemph B & Bremer E (1995): PE
opuAABC opuAA 320943..320994 -47:+5 AATATGCTGTTTGTGTGGGAAGTTACATAAATGTTACGGTAATAAAGATTGC Kemph B & Bremer E (1995): PE
opuBABCD opuBA 3463307..3463361 -42:+13 GTAAACTTTTTATTTTATAAACTTTATTCTATAATGGGAAGCATTCAATTGTCTG Kappes RM, et al. (1999): PE
opuE opuE 728429..728471 -40:+3 CGCTTGAATGGCCGGGAATACTTTGTTAGGTTAAGTTACCAAG Von Blohn C, et al. (1997): PE
Spiegelhalter F & Bremer E (1998): NB RG DP SDM
pabBAC-sul-folBK-yazB-yacF-lysS pabB 82788..82837 -43:+7 GAAATTCACTTTTTTCACTAACAACATTGCTTTACAATTAAAAACAAGTA De Saizieu A, et al. (1997): PE RG NB
pckA pckA 3129432..3129505 -59:+15 ACACACAAAAAACAATAAATAGTATAGACTATTTGAAAATATATGTTATACTAATTCACAATTAGCAAAACACA Servant P, et al. (2005): PE
pbpD-yuxK pbpD 3233844..3233908 -47:+18 CTAAATTTAACCTTCTCGTAATCTCAAAAGAATGGTACGATATGGCTAGAATTTAGGAGAAAAGA Popham DL, et al. (1994): PE
pbpF pbpF 1083734..1083798 -49:+16 GCCACCTCCTGCTTGCTAGTATATCAAAACAATGGTATAAGTTTCTATTGGCGAGTGCTTCGAAC Popham DL, et al. (1993): PE
pdhABCD pdhA 1528191..1528266 -64:+12 AAGGTTTTGGCAAACTGGGGATCGGCTAAAATATAATACGACTTACTGCTGATACTTTAGGGTACCCTAAGTTTGT Gao H, et al. (2002): NB PE
Hemila H, et al. (1990): NB
pdhABCD pdhC 1530383..1530460 -70:+8 AGACGTTCTTGAAACAGCAAGAAAAGTGCTTGAATTTTAATCAAACTGCATAATCGAGAGGGAAGATGAACGTTTTCC Gao H, et al. (2002): NB PE
Hemila H, et al. (1990): NB
perR perR 944399..944444 -41:+5 ATCAATTGACAAATTATCGTAGAAAGAGTTACACTAATTATAAACA Fuangthong M, et al. (2002): PE HM
cggR-gapA-pgk-tpiA-pgm-eno pgk 3481628..3481685 -49:+9 AAAGGACCTGACTTGGTTCTTTCGAATAGAAGCGCTATAATGAAAGCGGACAAGGGAA Ludwig H, et al. (2001): PE
pheST pheS 2930786..2930828 -38:+5 AGTGTTGCGCCAAGCGTTGGATTTCTCTATAATAGAACATAAT Brakhage AA, et al. (1990): PE S1
phoA phoA 1018471..1018540 -53:+17 TTGTTTACATGATCAACAGCCGCATTTAACAAAGTTTCCCTAACATGATAAACGGAATACATTAAAGGAG Hulett FM, et al. (1994): PE
phoB-ydhF phoB 621519..621567 -45:+4 AAATCGATTAATACTAGCTTAACAGTTTAAAAATATAATTGGGTTGTCA Chesnut RS, et al. (1991): PE DP
Abdel-Fattah WR, et al. (2005): RG
Allenby NE, et al. (2005): DB AR
phoPR phoP 2978588..2978631 -40:+4 CGAATTGTCGGAATGTCCTGCTTTCGCTAAAATAAAATCATGAA Pragai Z, et al. (2004): NB PE
Paul S, et al. (2004): PE, in-vitro reconstitution
phoPR phoP 2978566..2978610 -39:+6 TTTCGCTAAAATAAAATCATGAAACATGTTAAGATGACATAAAAT Pragai Z, et al. (2004): NB PE
Paul S, et al. (2004): PE, in-vitro reconstitution
phoPR phoP 2978688..2978743 -46:+10 ATTATCCTAATAAAAAGAGAGAAAGGCTTGCTTAATACAGCCTTTCTCTTTTTACT Puri-Taneja A, et al. (2005): PE, in-vitro reconstitution
rapE-phrE phrE 2660205..2660265 -50:+10 TCTGGAAGAGCTGGCATTGTTAGGAGGCAACCTTTTCGATTATAATGGAAAAATAGAGGAT McQuade RS, et al. (2001): PE RG
rapI-phrI phrI 548269..548338 -56:+14 AAGAATGCATTTTCATATCTGGCTTCGAGAAAAATGTTTGCTGATGTTGAAAATTTTTCGATTGAAGTCG McQuade RS, et al. (2001): PE RG
pmi pmi 3688683..3688742 -50:+10 TCGAGGAAAAGGCTGAAACAAAGCTTCTTTTCGACGTGATATAATAGATAGGAAGCGTTT Margot P, et al. (1994): PE SDS-PAGE
ppiB ppiB 2435806..2435869 -47:+17 AGCCGCGACAAGGAGAGACAGGCTATAACCTATACATAATCTCCTTTGAAAATTAAAATAAAGA Herrler M, et al. (1994): PE
pssA-ybfM-psd pssA 247514..247559 None GCGTCTTGTCCTTTTTATGCGGGGGGATAAAATAGTAAGGAACATG Cao M & Helmann JD (2004): ROMA RG
pssA-ybfM-psd pssA 247574..247618 None CATTTTTCAAAAGGTAACAAATGTTGTATAATAATAGAATTTGAA Cao M & Helmann JD (2004): ROMA RG
pst pstS 2581652..2581701 -43:+7 TTCGGTTCAAACCCTTTTTACATAGAACCTTTACTCTATACGTGTAGGAC Qi Y, at al. (1997): PE RG
pta pta 3866359..3866401 -38:+5 CTGTTTGAATTTGATTGGAAGAAGAGTATGCTAGTAAAAGAAA Shin BS, et al. (1999): PE
ptsGHI ptsG 1459303..1459348 -37:+9 TGCTTGTCAGATGACAAGTACGGTTGTATGATATAATATTGTGAAG Stulke J, et al. (1997): RG NB PE
ptsGHI ptsH 1456807..1456858 -45:+7 TGTTGTTATTGAAAAATGAATATCCGCTATGCTACAATACAGCTTGGAAATT Stulke J, et al. (1997): RG NB PE
pucABCDE pucA 3341052..3341098 -40:+7 CTTCGTTTGACTCTTTTTACAAATCCTCTTTCTATGTGTTTCATTTT Beier L, et al. (2002): PE HM
yurHG yurH 3343692..3343738 -41:+6 CTGTCAATGAACTATCATGTTGCTCCTTCTATAATGAAGTCACCATA Beier L, et al. (2002): PE HM
pucH pucH 3328650..3328693 -39:+5 TTGCTGATGTAATACGATCATAGTAGCAGTAAACTGTTGAAAAT Beier L, et al. (2002): PE HM
ywoE ywoE 3753809..3753857 -43:+6 ATAGCCAGTGTTATTGTCTGACTCTTCAGTTATATTAAGTGACATCTAA Beier L, et al. (2002): PE HM
pucRJKLM pucJ 3330435..3330480 -40:+6 ATCCAATGACACCCCTCGACCGGAACGATATTATGTTACTAAAGTT Beier L, et al. (2002): PE HM
purA purA 4156752..4156815 -46:+18 CGGATTTACAATTGACTTTCTGTTTCTTCACTGATAAACTTGATTTGTTTGAATAGAATCGTTT Mantsala P, et al. (1992): PE
purEKBCSQLFMNHD purE 698325..698389 -45:+20 TCGATAATATCGTTGACATTATCCATGTCCGTTGTTAAGATAAACATGAAATCAAAACACGACCT Ebbole DJ & Zalkin H (1987): S1 PE
purT purT 243832..243873 -39:+3 AAAAATTTATTTTTCAAATATTTCAGTTATAATGGTTTGGAA Saxild HH, et al. (1995): PE
pyrRPBCAAABKDFE pyrR 1618114..1618157 -40:+4 ACGGTTGACAGAGGGTTTCTTTTCTGAAATAATAAACGAAGCTG Quinn CL, et al. (1991): NB PE
qcrABC qcrA 2365155..2365199 -39:+6 TATATTGACCTTGCTGAGAGATTCATATATTATGAGGGTGTCTAG Yu J, et al. (1995): PE HM
rapA-phrA rapA 1315788..1315856 -50:+19 TGCGGTTATTTTGCGTTCTTCTTTTTCTTGTAAATATGATAAAATATGACATATCTCGGGTAATTCAAA Mueller JP, et al. (1992): PE
Jarmer H, et al. (2001): PE SDM HM
rapB rapB 3772158..3772211 None TTGTAAGAAAATTTAATTCCAAAGCCATACATTATGATAAAATATAACCAATTA Jarmer H, et al. (2001): SDM HM
rapC-phrC rapC 428763..428802 -36:+4 GGGTTGGGACGGCCTATAAACATGATAAAATATGACATAA Lazazzera BA, et al. (1999): PE
rapD rapD 3744278..3744324 -41:+6 CTGTCAATGAGAGCCGTCAAAAGTTATGATATGATAATTATAGATTT Huang X & Helmann JD (1998): PE RO RG
Jarmer H, et al. (2001): HM
rapG-phrG rapG 4140181..4140219 -34:+5 TTTTACATAAAATAGAAAGAGGTGTTACTATCAGAATAA Hayashi K, et al. (2006): PE
rapH-phrH rapH 750886..750931 -42:+4 CTTCCTTCTATATTGTTTTCAAAATTTGGGATTGATAGAATATGAC Hayashi K, et al. (2006): PE
rbsRKDACB rbsR 3701330..3701396 -49:+18 TTTGATATTTTTATTGCTAACTTCGGATTGTTCATGATAATCTATCTATGTAAACGGTTACATAAAC O'Reilly M, et al. (1994): PE
recA recA 1764569..1764633 -45:+20 TTCGCTTTTTTCTTGGCAAATCCCTTCAAACAGGGTATAGTATATGTAGTGGTAACATAAAGGAG Cheo DL, et al. (1993): S1
resABCDE resA 2421371..2421425 -51:+4 CTTCAAAAAGTAAGAAATGTGAAATGAACGTGCAATGATATAATTGAATGGATCT Sun G, et al. (1996): PE
resABCDE resD 2417923..2417970 -43:+5 ACACAGTTCTCAAACTTTCTCACGATTTGATAAAATGAAAGTAACAGA Sun G, et al. (1996): PE
rpmH rpmH 4215404..4215475 -49:+23 ACTAGTGAAGTTGACAATGAATAGGTAACGCAAATATAATAAGTAAGACTGTCTTTAACAGCTATTCCTCGA Ogasawara N, et al. (1985): S1
rpmH rpmH 4215486..4215536 -41:+10 AAATAAGGTTTCGAAAGTTGAAAAGGTATGGTATCCTATTATGGTTGCAAG Ogasawara N, et al. (1985): S1
rocR rocR 4145668..4145716 -45:+4 AAAATTCTTTTGCATATCCTCTCCGTTTTTTTATAAAATAGAAGCAATA Gardan R, et al. (1995): PE
rpoB rpoB 121665..121709 -41:+4 AAAGTTTGACTCGGTATTTTAACTATGTTAATATTGTAAAATGCC Boor KJ, et al. (1995): PE SDM
ywjF-acdA-rpoE rpoE 3813138..3813201 -52:+12 ATTAACGCTGTTAAGGGTAGCATATTCTGTTTTATTTTGTTTATAATGAGAGGTATGGTTTGTA Lopez de Saro FJ, et al. (1999): PE
rpsD rpsD 3035501..3035564 -47:+17 TGGAGGAATGGTTGACTTCAAAACAAATAAATTATATAATGACCTTTGTGTGAAATATTGCAGC Grundy FJ, et al. (1990): PE
rrnA-16S-trnA-Ile-trnA-Ala-rrnA-23S-rrnA-5S rrnA-16S 30039..30105 -46:+21 ATATTATGTATTGACTTAGACAACTGAAGGTGTTATTCTAATATACGTCGCTGATGACGAACAGCTT Ogasawara N, et al. (1983): S1
rrnA-16S-trnA-Ile-trnA-Ala-rrnA-23S-rrnA-5S rrnA-16S 30123..30181 -45:+14 TAAAAAGTTGTTGACAGTAGCGGCGGTAAATGTTATGATAATAAAGTCGCTTAAACGAG Ogasawara N, et al. (1983): S1
trnB rrnB-16S 3178892..3178956 -48:+17 TTTAAAAAACTATTGCAATAAATAAATACAGGTGTTATATTATTAAACGTCGCTGATGCACAGCG Stewart GC, et al. (1983): S1
Estrem ST, et al. (1999): ND
trnB rrnB-16S 3178799..3178861 -43:+20 AAAAAAGTTGTTGACAAAAAAGAAGCTGAATGTTATATTAGTAAAGCTGCTTCATTGAGAAGT Stewart GC, et al. (1983): S1
rrnD rrnD-16S 946379..946441 None AAAAAGGTGTTGACTCTGATTCTTGACCGTGTTATATTATTAAACGTCGCTGATGCGCTTCTG Jarvis ED, et al. (1990): HM
rrnD rrnD-16S 946476..946538 None AAAAAAACATTTGACAAAAGAAAGTCAAAATGTTATATTAATAAAGTCGCTTCAACAAGAAGT Jarvis ED, et al. (1990): HM
rrnO-16S-trnO-Ile-trnO-Ala-rrnO-23S-rrnO-5S rrnO-16S 9494..9556 -46:+17 TGTCATAACCCTTTACAGTCATAAAAATTATGGTATAATCATTTCTGTTGTCTTTTTAAAGAC Ogasawara N, et al. (1983): S1
rrnO-16S-trnO-Ile-trnO-Ala-rrnO-23S-rrnO-5S rrnO-16S 9592..9654 -45:+18 CAAAAAAGTATTGACCTAGTTAACTAAAAATGTTACTATTAAGTAGTCGCTTTGAGAGAAGCA Ogasawara N, et al. (1983): S1
rsbRSTUVW-sigB-rsbX rsbR 519317..519382 -45:+21 AGAGCAACTTTTTTTGTTTTCAAAAAACATAAACGATATAATAGTGAAATAACGAAAAAATATGTT Wise AA, et al. (1995): PE
sacB-yveBA sacB 3535769..3535823 -44:+11 ATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGAGGTCGAAAAGTAAAT Shimotsu H & Henner DJ (1986): S1
Steinmetz M & Aymerich S (1986): DP, levansucrase activity
Tsukahara K, et al. (2008): PE (data not shown)
sacPA-ywdA sacP 3905167..3905217 -38:+13 AAAAATAGTTGACGAAAACGCTATCATGATTTATGATGAAAGCGTATTCTT Arnaud M, et al. (1996): RO
sacXY sacX 3941899..3941966 -48:+20 CTTTTCATACTATTGCTATACAGCCATGAACAGCATAAAATGAACGTTATTACAGTTATCACCACATA Crutz AM & Steinmetz M (1992): PE
sboAX-albABCDEFG sboA 3835968..3836017 -45:+5 AATATATGTATTGAATTAGTAATTTGATAGTTTTAAGATAAAAGTACAAC Zheng G, et al. (2000): PE
yaaJ-scr scr 26337..26389 -42:+11 GTACGGTTGCAATTTTTAGGGGAAACAGATATACTTAAGTGTGCATCGTAATA Struck JC, et al. (1989): S1
sda sda 2647330..2647376 -42:+5 AGAACGATTGTTCTTATATGCATTTCATGGTAGATTAAAGATAACTT Burkholder WF, et al. (2001): PE RG
yaaJ-scr yaaJ 25764..25807 None CAATCGACAGTCTCCTTTCCGTTTCAGTTATAGTTAATATGTAG Struck JC, et al. (1990): RG HM
sdhCAB sdhC 2908810..2908871 -44:+18 CGCGTTTTCTTGACGCCCTTTTGAGGGAGGAGTAAAATGAAATTGTCAATAAATCTTAATAA Melin L, et al. (1989): PE
sdpRI yvbA 3467377..3467421 -37:+8 GGGTTGTTTTTAAAAAAATTCAAGTTATAATGAAAATAATACATT Ellermeier CD, et al. (2006): PE
secA-prfB secA 3630898..3630950 -42:+11 CAAATTCTTTGGAAATAACAAAAGGTATGATATGATAATGAGAGGTATACATG Herbort M, et al. (1999): PE RG, Western blotting
fla-che sigD 1716433..1716483 -44:+7 ATATTCGAACTGTTAAACAAGGTGAAAAAACGATTTAATTAAGGTATTAGG Allmansberger R (1997): PE DP
sigH sigH 116530..116592 -45:+18 TAGATTAAGTTGACGCTTTTTTGCCCAATACTGTATAATATTTCTATCTACGTGCGCCGGGGG Weir J, et al. (1991): PE
sigM-yhdLK sigM 1030159..1030205 -43:+4 CTCCGCACTATCTTTTGCGGCCATTTTTGGGTACTATATAGTAATGG Horsburgh MJ & Moir A (1999): PE NB RG
sigX-rsiX sigX 2415259..2415302 -40:+4 TTCCCTTCCAAATTCCAGTTACTCGTAATATAGTTGTAATGTAA Huang X, et al. (1997): RO PE RG
Huang X & Helmann JD (1998): PE
sinIR sinI 2552271..2552330 -53:+7 ACCATTCGACATCATTCTCGTTTTTTTTGAGAAAATACGATTATAATAAAGGTATATTGG Gaur NK, et al. (1988): PE HM
Shafikhani SH, et al. (2002): PE
sinIR sinI 2552352..2552397 -41:+5 TGGCAAATGACTTCCAGAGACTAATGAAGCATACAATAAGTCATGG Gaur NK, et al. (1988): PE HM
sinIR sinR 2552589..2552648 -49:+11 AGCCAGAAGTCATACCGTAAATCCTTTCTGAATGTGCTATAATATCACAAGGAAGGTGAT Gaur NK, et al. (1988): PE HM
Shafikhani SH, et al. (2002): PE
gapB-speD speD 2966927..2966972 -40:+6 GCACCTTGCAAATTAGACTTAAACACAGTATACTATTTTTCGTGAA Sekowska A, et al. (2000): PE NB
spo0A spo0A 2519010..2519067 -43:+15 CCCTCTTCACTTCTCAGAATACATACGGTAAAATATACAAAAGAAGATTTTTCGACAA Chibazakura T, et al. (1991): S1
Eymann C, et al. (2001): NB
spo0A spo0A 2519019..2519072 -42:+12 TTGATCCCTCTTCACTTCTCAGAATACATACGGTAAAATATACAAAAGAAGATT Predich M, et al. (1992): PE
Eymann C, et al. (2001): NB
spo0B-obg spo0B 2854595..2854661 -50:+17 GGAAAAACAATTGTTTTTCTAACAAAGCCTTCTCTGTTATAATTCATAATACACACTTATACAGACT Trach K, et al. (1989): S1
spo0E spo0E 1430587..1430651 -49:+16 AATGAAAATATGTTTACAAATAAAGTATAATCTGTAATAATGCACAATAACCCAATCAAACTTGT Perego M, et al. (1991): PE
spo0F spo0F 3809979..3810042 -44:+20 GAAAATGCTCAGAAAATGTCGTAAAGTAGACTATTATAATTAAAGGAAATAGGAAAATCAAACA Trach K, et al. (1988): S1
Lewandoski M, et al. (1986): S1
spoIIE spoIIE 70458..70524 -51:+16 TTACCTTCTTTTGACAAAATCCTATCTGTGCTTTCGCTATAATGACAGGCAACGAATATAACAGGTG York K, et al. (1992): PE
Guzman P, et al. (1988): S1 DP RG
spoIIGA-sigE-sigG spoIIGA 1603685..1603752 -49:+19 TCAACATTAATTGACAGACTTTCCCACAGAGCTTGCTTTATACTTATGAAGCAAGAAGGGGAACAGCG Kenney TJ, et al. (1989): PE
spoIIIE spoIIIE 1752152..1752195 -41:+3 CCAACCCTTTTTTAAGGGCAAAATATGCTATAATAGGGGAATCC Foulger D & Errington J (1989): PE RG
srfAA-srfAB-comS-srfAC-srfAD srfAA 376632..376694 -46:+17 CCATTTTTCGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATAT Nakano MM, et al. (1991): PE
tagAB tagA 3681253..3681299 -42:+5 TAATGTTAATCCTTTGTTGAAGATTTATGTTAAAATATAAGGTAGCT Mauel C, et al. (1995): PE
tagDEF tagD 3681086..3681131 -40:+6 AGTACTTAACCTTTTTTAGGCGGTATGCTATAATTAATGATCAGTG Mauel C, et al. (1995): PE
tetLB tetL 4189159..4189221 -45:+18 AAAGTAAAAGTTTAATCCTTAGTCTATATATAATAAGATCATATCAATCAAATGTAGGGGGAG Sakaguchi R, et al. (1988): S1
thrS thrS 2961475..2961536 -42:+20 GCGATCGTGTTGATTTTTTGGATTGAACAATTTATAATACATAGGAGATTAAGAAAGACACA Gendron N, et al. (1994): PE RO
thrZ-ywhA thrZ 3856975..3857012 None CTGATTGCGCTTTGTGGGAATATATAGTAAGATATAAA Putzer H, et al. (1992): NB DP, Western blot
trePAR treP 850283..850324 -38:+4 GTGTTGACTACCTGTATATACAGGAATACAATATGATTATAA Schock F & Dahl MK (1996): PE
rrnD trnD-Asn 951403..951453 -39:+12 AACACTTGATTTTCTCAAGAATACATAGTATAATGTTAAATGTCACTGAAA Vold BS, et al. (1988): S1
rrnD trnD-Leu2 953138..953197 -47:+13 TTTTTTGAAATACGTTGACACTTTATGAGATCCATGATATATTTATATTCGTCGGTTAGA Vold BS, et al. (1988): S1
trpEDCFBA-hisC-tyrA-aroE trpE 2377612..2377666 -47:+8 CCGATTTATCATTGACAAAAAATACTGAATTGTAATACGATAAGAACAGCTTAGA Shimotsu H & Henner DJ (1984): S1 DP RG
Shimotsu H, et al. (1986): S1
trxA trxA 2913349..2913405 -37:+20 AAAATAGCGTGAACGAATGGGAGATGCTATACTAAAAATCATCATTTCACATTGGAG Scharf C, et al. (1998): PE, 2D-gel
tyrS tyrS 3038151..3038211 -43:+18 AGGCGGCGTTGACACAGGATTTTATTTATGTTAAAAATGATATAGCTTCATATGAAAAGGT Henkin TM, et al. (1992): PE
ureABC ureA 3769940..3769985 -38:+8 TTCTTTGAATTAATAGGCCTCTTCTATATAATGATGACATAAGTTG Wray LV Jr, et al. (1997): PE RG
valS-folC valS 2869611..2869661 -43:+8 AGATGATTGACGAATCAAAAACACTTTTACTATAATAAAGAACATAAATAA Luo D, et al. (1997): PE NB
veg veg 52704..52765 -44:+18 AAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGTGAGGTGGATGCAATG Whipple FW, et al. (1992): RO FT
Le Grice SF & Sonenshein AL (1982): FT NB
Moran CP Jr, et al. (1982): RO, in-vitro transcription
Fukushima T, et al. (2003): PE NB RG
wapA-yxxG wapA 4030580..4030623 -40:+4 AAATATTGTAATGATATTTCAGTCTAGTTAAGATTATTGAGTAA Dartois V, et al. (1998): PE RG
xpt-pbuX xpt 2320206..2320250 -40:+5 CAGCCTATGCAAGAGATTAGAATCTTGATATAATTTATTACAATA Christiansen LC, et al. (1997): PE HM
xsa xsa 2915239..2915285 -38:+9 GTCGTTGACATGTACGAACATATATAATATGGTTACTTTAAAAGCGC Raposo MP, et al. (2004): RG PE
xylAB xylA 1891760..1891821 -44:+18 CTAAAAAAAATATTGAAAATACTGACGAGGTTATATAAGATGAAAATAAGTTAGTTTGTTTA Hastrup S (1988): Genetics and biotechnology of Bacilli, vol.2 p.79-83: S1
Gartner D, et al. (1988): S1
xynA xynA 2055328..2055387 -49:+11 ATTACAAATACTTTTAATATTTGCTCATGAATTCGTGGTATTATACTGAAGGGGACGATC Allmansberger R (1996): PE NB
xynPB xynP 1886984..1887041 -47:+11 CTGAAAAAGATGTTGAAAAAGTCGAAAGGATTTTATAATATTAAGTCAAGTTAGTTTG Hastrup S (1988): Genetics and biotechnology of Bacilli, vol.2 p.79-83: S1
Galinier A, et al. (1999): PE DP
yaaA-recF-yaaB-gyrB yaaA 3139..3190 -41:+11 CCCTTTCCCTAATTCGTTTTTTTTTAGTACAATTAGATATTAGTGATATTTG Ogasawara N, et al. (1985): S1
yaaA-recF-yaaB-gyrB yaaB 3599..3668 -51:+19 TCAAATGACAAAGAACTTATACGGTGGGACAAAGACTATGCTAAAATAGAGGGAAGAGTGATGAAGCAAA Ogasawara N, et al. (1985): S1
skf ybcO 213824..213891 -64:+4 AATTTTTAGGATAATATACAAAATCCCCCTTACTTCGACAATTGCAATCTGGTATTATCGTATCGCAT Chen G, et al. (2006): PE
yccC yccC 290848..290893 -40:+6 GATCTTTTGACTGAATAGATAAAATGTACAATGATTAATCATCATA Fisher SH & Wray LV Jr (2002): PE
ycdHI-yceA ycdH 308229..308305 -43:+34 ATTTATTCTTGCAAAACGTAATGACTTCGGTTTATTATGATATAGGATTACAAAATCGTTATCATTTTGATTTAAAG Gaballa A, et al. (2002): PE
yceCDEFGH yceC 312022..312068 -45:+2 TCGTCAATTATTCTTAACTTTTACGAAACTTTGATATAATAACAAAC Cao M, et al. (2002): PE
yciABC yciA 364181..364245 -40:+25 TTTCTCTTGATTTTCAACAGTGAACCGATCAAAATAAATAGTAATTATTACGATTTGTTAGTGAG Gaballa A, et al. (2002): PE
yciABC yciC 365752..365827 -50:+20 TGAATTGAAAACCGTTGACAAAAAGGAAAAAAGACCATACAATTTAAATCGTAACAATTACGTTTTATGATAAATG Gaballa A, et al. (2002): PE
Gabriel, S.E., et al. (2008): PE
rtpA-ycbK yczA 276758..276802 -40:+5 AGAATTGACTTCGTTTCATGAACCGAGTATTATAAACTCTACAAA Sarsero JP, et al. (2000): PE
ydfK ydfK 594120..594164 -41:+4 TCCCTTGACTCTCTACTAACTAGAGGGTTTATTTTTTATGCAGGA Baranova NN, et al. (1999): RO
yfkJIH yfkJ 861909..861960 -44:+8 GACATCAGTTGAAAAGAAAATGAACATCCTACTAAGATATTCATGAAGGTTT Price CW, et al. (2001): RACE-PCR
yfmPO yfmP 812075..812120 -41:+5 TTAACGTTTACGTTAAGGTTCAAAAGGTGTATAATGGTAACAGAAA Gaballa A, et al. (2002): PE
yhaG yhaG 1075228..1075288 -42:+19 AAAGTCTGGCTATGCAAACCGTCCGTTTGGTATACTGTTTGCATAACACATTCTGTAAAGC Sarsero JP, et al. (2000): PE
yhfL yhfL 1100888..1100969 -38:+44 GCTCTTGAGTGTTTTTTTCTGTTTCTCTATAATGGAGAAGAAAGCTTGGCTTCAATAATGAATGACTATTCATTCACTTAAG Matsuoka H, et al. (2006): PE NB
yjcIJ yjcI 1258242..1258288 -40:+7 AAGTGTTGAAATAAACTGTGAATTGCGCTAATATAAAACAATCAGAA Auger S, et al. (2002): PE
uxaC-yjmBCD-uxuA-yjmF-exuTR-uxaBA uxaC 1300358..1300405 -39:+9 GAGATTGATCCCAAAGGAATATAAAGGTAAAATAAAAACAAATCAAAA Mekjian KR, et al. (1999): PE SDM RG
yklA yklA 1380901..1380956 -50:+6 TTTATACGCGAAAAATTGACATTTCAAATTTAATTGTGTACAATTTAATTGTATAA Volker U, et al. (1998): PE HM
ykzB-ykoL ykoL 1398114..1398157 -39:+5 ATTCATACCACGTTCATTTAAAAAGAGTATCTTTTGTATAGGAT Robichon D, et al. (2000): NB PE
ykuFG ykuF 1477998..1478060 -36:+27 TGTGCTGACAGAGGCAGGGATATAATGATAGAATATTATTGAATGAATAATCATTCACAATTG Matsuoka H, et al. (2006): PE NB
ykuNOP ykuN 1486953..1487001 -44:+5 ATTTATCTGTTGACAATGAAAATCATTATCATTTAAAGTGATACATATG Baichoo N, et al. (2002): HM PE
ykvW ykvW 1451226..1451269 -38:+6 ATAATTGAAATTCTCTTCGTGCGTGCTATAATAAAGGAAGACAT Gaballa A & Helmann JD (2002): PE HB
ylaABCD ylaC 1544046..1544096 -41:+10 TTTATTGGCCATTTGGATGACGGTGTGGTTTTATTTTTAATGAAGCATAGG Matsumoto T, et al. (2005): NB PE RACE-PCR
ylxM-ffh ylxM 1671746..1671807 -45:+17 GATAAAAACTTGACAGTGTCATTAAAACCGTGTAAACTAAGTTATCGTAAAGGGATTTGACT Honda K, et al. (1993): PE
nrdIEF-ymaB ymaA 1868523..1868577 -46:+9 CGAATCTATATATTGTGTTTTTGCTAGAGGGTAGTATACTATATATAGTGTTAGT Hartig E, et al. (2006): PE
ccdA-yneIJ yneI 1923955..1924001 -42:+5 TCGTACTACTACTAATCCTTTTGTTTTTGGTACAATAAGACTATTAT Schiott T & Hederstedt L (2000): PE NB
ccdA-yneIJ yneJ 1924405..1924451 -42:+5 TCAAAATGGTTTTTTTTATTGTTTTGGAGTATAGTATATAGTATCAA Schiott T & Hederstedt L (2000): PE NB
yocH yocH 2093798..2093846 -44:+5 TTTTTGTTATTGATTTGACATTTACGTGTGTTACGATATCACCTGTTAG Howell A, et al. (2003): PE
ypuE-ribDEAHT ypuE 2431629..2431680 -43:+9 TATTTCATTGCGTACTTTAAAAAGGATCGCTATAATAACCAATAAGGACAAA Mironov VN, et al. (1994): NB S1
Perkins JB, et al. (1999): RG NB
txpA yqdB 2678145..2678205 -50:+11 TCATACTTTTTGAATGTGCTTTCCATATAATTCATGTATAATAGATTCTTGAAGCTACCTT Silvaggi JM, et al. (2005): PE NB
yqxD-dnaG-sigA yqxD 2604022..2604068 -42:+5 AACAATAGCATCTTTGTGAAGTTTGTATTATAATAAAAAATTGTGAT Wang LF, et al. (1987): S1
yqxD-dnaG-sigA yqxD 2604050..2604095 -42:+4 TGGCTGTGCCAAAAGGGAATAATGAAAAACAATAGCATCTTTGTGA Wang LF, et al. (1987): S1
lcfA-ysiAB-etfBA ysiA 2918562..2918628 -43:+24 GAATAAACTTGACAAACCTGAAAATCCTTCTTATCATGAAATTATGAATGAATAGTCATTCATTTCT Matsuoka H, et al. (2006): PE NB
ytkD ytkD 3135487..3135531 -40:+5 AAAGGCTTCCGAAGAAACGTAACTGTGGTATGATGTATGGAAGAT Ramirez MI, et al. (2004): PE NB RT-PCR
ytrABCDEF ytrA 3119478..3119524 -41:+6 AAAGGATTGACTTTGTGAGTCAAAGTATTTATTGTATTAAGTGTACT Yoshida KI, et al. (2000): NB PE
yusMLKJ yusL 3372410..3372502 -38:+55 CTATTGAAGTCGAACCGGAAATCTTTTAAGATGAAAGAAGAAACGGGTTTCATTTTTTTTAGTCAAAAAATGAATGACTATTCATTCAATGTT Matsuoka H, et al. (2006): PE NB
yuxH yuxH 3259283..3259348 -49:+17 TTTTCATGTTTAGACAATTTTCGTCAAATTATTTGATATACTTAGGGGTGAAAGCCGCGCGTATTG Weinrauch Y, et al. (1989): PE
eps yveK 3529906..3529955 -44:+6 TTTTGCAATTTTTAAATAATAACGTTTTCTTTTATAATCCAATCATTAAC Kearns DB, et al. (2005): PE
yvgRQ yvgR 3434196..3434240 -40:+5 TATATTTTACTTAAGCCTAGTATTCCGGTAAAGTTCAATTAGATG Guillouard I, et al. (2002): PE
ywbI-thiME ywbI 3933142..3933190 -40:+9 TACTTATTGTACATAAGGTCTCTCTATAGGTAAAATATATATTAAGAAT Zhang Y, et al. (1997): PE NB
ywcJ ywcJ 3905265..3905314 -41:+9 TAATTGTGAAATACTTCACAATATCGTGCTATACTATGCTCAATCATGAA Cruz Ramos H, et al. (1995): PE
Reents H, et al. (2006): PE
ywfK ywfK 3865251..3865293 -39:+4 CCTTCTTTACCAAGACGGATGATATGAGTACAATAAAGAAAAC Guillouard I, et al. (2002): PE
ywjF-acdA-rpoE ywjF 3816557..3816599 -37:+6 TATTGACTGAACACTCATTCATTATTTATCATAAAGATAATCT Matsuoka H, et al. (2006): PE NB
pyrG pyrG 3812472..3812524 -45:+8 AAAACGATCTTGACTTTCATAGTCGAACTATGTAGTATGTATTTTGGGCTCTT Meng Q, et al. (2004): PE
yqxM-sipW-tasA yqxM 2555304..2555349 -42:+4 GGTGTTTTTAAATCTATAAATCGTTGATTATACTCTATTTGTGAAG Chu F, et al. (2006): PE
ezrA ezrA 3031494..3031571 -58:+20 GCACAAAAAGTTTTTGATTTCTGGTCAAAAAATGTTTGTTACATGGTATCATAATAACAATGAAAACGACAGTTTTTC Chung KM, et al. (2004): PE RG
ezrA ezrA 3031469..3031543 -55:+20 AAAATGTTTGTTACATGGTATCATAATAACAATGAAAACGACAGTTTTTCTCAATACATATCCTGAAATCTTTCT Chung KM, et al. (2004): PE RG
yxaAB yxaA 4113254..4113304 -43:+8 GCATGGTATGTATTTCCAGATCAATTATGGTACATTGGAGATCAATAGGTT Nagorska K, et al. (2008): 5' RACE
yxeKLMNOPQ yxeK 4062215..4062281 -58:+9 AGAAAAAATTAATCTTAACTCATTGACAAACGTCCAAGACAAAGGTACATTTTGATTTATTCATATT Auger S (2003): Thesis: PE
Even S, et al. (2006): PE
yrrT-mtn-yrhABC yrrT 2788537..2788605 -59:+10 ATAAAATACACAAAGTGTTTTAGTACCTGCTTTTCAGAATATGTGGTATTATAGGAACTGTTCCATCAT Auger S (2003): Thesis: PE
Even S, et al. (2006): PE
yhcL yhcL 986906..986971 -53:+13 GTTAAAATAATTCGCACTTGACCCATCGGAATTAGTGTAATATAGTAAATGAGAAAATTTGAAGGG Auger S (2003): Thesis: PE
Even S, et al. (2006): PE
ssuBACD-ygaN ssuB 961224..961285 -47:+15 ATTTAAAAAAGAGTTGACATATCGGAATAATTTGAATTAACATGTTATTCAAACAAAAAAAC Van der Ploeg JR, et al. (2001): PE
cymR-yrvO-trmU cymR 2812207..2812265 -49:+10 CCTTCTGCCTCAATGAAAATTCGCTGAAGGTATGTTATAATAACAGTTGGTCTATAAGA Choi SY, et al. (2006): PE
yjbCD yjbD 1227570..1227628 -49:+10 TTTTCTTAGGATACTGTTCACACTTACTTTTTTATAGTATAATACCTGTAAAGATTCCT Leelakriangsak M, et al. (2007): PE
ntdABC-glcP ntdA 1129644..1129703 -50:+10 CTTAAAAAAGTTGTTGACATGTTACCGATTTCAGAAACTAGGATAAATTTGTAATAAATT Inaoka T, et al. (2004): PE
yvqIHGFEC yvqI 3398947..3399006 -50:+10 AATCAATCTCTGATTCGTTTTGCATATCTTCCAACTTGTATAAGATGAAGACAAGGAAAA Mascher T, et al. (2004): PE
yhcYZ-yhdA yhcY 1008592..1008651 -50:+10 CATCCTACAAGTGAAGCAATGAAATACAAAAAACTGGTATAATCTTAAATACAAGATCAA Jordan S, et al. (2006): PE
liaGFSR liaG 3397756..3397815 -50:+10 CTTCCCTTCCGCACGTATCAATTCGCAAGCTTTTCCTTTATAATAGAATGAATGAGAAGG Jordan S, et al. (2006): Data not shown
yydFGHIJ yydF 4127663..4127722 -50:+10 TTTAGGTACAATATATTGACATGTATTGAATGATATAGAATAATTGGTTTATATTAGAAA Butcher BG, et al. (2007): 5' RACE PCR
yvaB yvaB 3446149..3446208 -50:+10 ATTCGAGATGTTTTACTTGAAAGTAAATTTCTTTGTCTCTATAATAAAGTCTAAGAGAGA Towe S, et al. (2007): PE
mhqED yodE 2130016..2130075 -50:+10 TCAAAACACATGGTTTGCATCCTTTTCAATAAAGGTTTAAAATAATAAATATCTTGAAAT Towe S, et al. (2007): PE
mhqA mhqA 1352961..1353020 -50:+10 GGTGAAGCTGATATGTTGACTTTCTCATGCGAATAAAATACTTTGTTATTAGAACAATAA Towe S, et al. (2007): PE
mhqNOP ydfN 596270..596329 -50:+10 AATTTTCAAAAACCTATTGACATGAGAAGATCTGTATTTTACTATTATCTCATATTCAAG Towe S, et al. (2007): PE
lytE lytE 1018886..1018945 50:+10 ACATGAAGTCAAGACTATTTCTGATGGGAATCTATCCTTATAATAGAAATCAATAAGATT Ishikawa S, et al. (1998): PE
narK-fnr fnr 3832239..3832304 -48:+18 TTAGTTTTTTCTCGATGGGTACAAATCAATTCACGTTACAATAAACACACAACGTGACTTTCTTCG Cruz Ramos H, et al. (1995): PE
hmp hmp 1372703..1372763 -50:+11 GATTCATTTTAGATATATCTTTTATTCGTAAGATCATGTATTTTAAAGATATATTTTAAAT LaCelle M, et al. (1996): PE DP RG
Nakano MM, et al. (2006): PE
narK-fnr narK 3833538..3833597 -52:+8 ACGTGTGATGTAATTCACAATCCTGTTTGGCTAGTTTTTGTATGATAAGACTGATTATTG Cruz Ramos H, et al. (1995): PE
phoD phoD 283940..283989 -44:+6 CACTTCTTCACAGTCGTTTAACAATGATTTCCTATAATGGAGACGATCAA Eder S, et al. (1999): PE
rnc-smc-ftsY rnc ND ND ND Kakeshita H, et al. (2000): NB
sipS sipS 2433609..2433657 -40:+9 ACCAAGCTGAGAAACGAACCCAATTAGTATGTAATCAAAATTAAGTAAA Bolhuis A, et al. (1996): PE NB RG
spoIIIJ-jag spoIIIJ 4214647..4214698 -44:+8 GAAAAAGACACCATTTAAAACTGAAAGATGCTAAAATACATACAAGTATGCT Errington J, et al. (1992): PE RG
tuaABCDEFGH tuaA 3658932..3658981 -44:+6 ATACCATTTACATCCAATTAACATCCGTCTGCTAAACTGACTGGCATAGG Soldo B, et al. (1999): PE
ywkAB ywkA 3802235..3802294 -49:+11 GTAATTTTCTTCTCTTGAATTTTGATTTTGACAGGCATACAATAGCTTACGTAATGTAAA Doan T, et al. (2003): PE
mtnU ykrU 1425562..1425631 -55:+15 CCTTCTAAAAAAATCTTGAAATGATAGTCCATCATCATATATGGTTAAATGAAAAAAGTAAAGAAAAATT Sekowska A & Danchin A (2002): PE
mtnV ykrV 1425560..1425629 -47:+23 CAAATTTTTCTTTACTTTTTTCATTTAACCATATATGATGATGGACTATCATTTCAAGATTTTTTTAGAA Sekowska A & Danchin A (2002): PE
mtnKA ykrT 1424702..1424770 -49:+20 TTAAAAAATATATTGACAACTAACTAAATTACCTGTTACCATGTTCATCAACTGATAAATTAGAATTGT Sekowska A & Danchin A (2002): PE
mtnWXBD ykrW 1426807..1426882 -50:+26 TACCCAAAAAAGCATTGACAAGACCTTATAACGATGGGATAATTCAAAATAATTTATAAAATCTATATTTTCTTAT Sekowska A & Danchin A (2002): PE
mtnWXBD ykrW 1426823..1426886 -53:+11 GACAAGACCTTATAACGATGGGATAATTCAAAATAATTTATAAAATCTATATTTTCTTATCAAG Sekowska A & Danchin A (2002): PE
ytmIJKLMNO-ytnIJ-ribR-ytnLM ytmI 3008822..3008896 -54:+21 AAGGTTTACTTTTTTTGATTAGTCAAAGATCAGAGTATGCTTTATAGTATAAACAATAAAAGCTTAGTAAACAAA Burguiere P, et al. (2005): PE
Erwin KN, et al. (2005): PE
Solovieva IM, et al. (2004): NB
ytlI ytlI 3008806..3008879 -54:+20 AAATATATAATTCCTATTTGTTTACTAAGCTTTTATTGTTTATACTATAAAGCATACTCTGATCTTTGACTAAT Burguiere P, et al. (2005): PE
ytlI ytlI 3008806..3008879 -51:+23 AAATATATAATTCCTATTTGTTTACTAAGCTTTTATTGTTTATACTATAAAGCATACTCTGATCTTTGACTAAT Erwin KN, et al. (2005): PE
speE-speB speE 3849689..3849753 -53:+12 CAGAACAGGACGCATCTTTACTTTTTCCCCGCCATCCTCTATACTTTTTCCTTAGGTGAAAATGA Sekowska A, et al. (1998): PE
yflG-yflH yflG 840485..840570 -55:+31 TTTTCCCAGGTCCGTGTGTTTCCTATTTTTAAGACAGTTGTGGTAAGCTTAATCTAGATTATTTAAAAAGAAAGCGGGAATGACAG You C, et al. (2005): PE
ydfJ ydfJ 589631..589694 -50:+14 CATGCCCGAATGTACGTTTTTTTCATTTCATTGTCAACTACAATGAGAAAGAATGTGATCAAGC Serizawa M, et al. (2005): PE
bceAB bceA 3112105..3112166 -52:+10 TTTTGTTCGCCGTATCGAAGGAAAAGCCCGGCATTCCTTTTTATAATGAGATTATCCAATAT Ohki R, et al. (2003): PE
gmuBACDREFG gmuB 626541..626600 -50:+10 TATTTTATAAAAGTATAGACATTTAAAATTAAATGACTATAATAATCAATGTAAGCGTTT Sadaie Y, et al. (2008): PE
yrkO yrkO 2705283..2705342 -50:+10 ATGATGACTCTTCATAAATTGTTAAGATTCGGTCTTTATATTTATCCATTGTAAGGCTCA Ogura M, et al. (2008): PE
yrkPQR yrkP 2705171..2705230 -50:+10 TTAAGATTTACGTAGTATCTTATAACGTACTTATTACTATGAACGATATATAGTAAGGAC Ogura M, et al. (2008): PE
yclHI yclI 426420..426479 -50:+10 AGAAATAGATTGTTCATATTTTTTTCATACCTTTGGACTACTATTAATTTATCAGCAAGG Ogura M, et al. (2010): PE
ykcBC ykcB 1354217..1354276 -50:+10 TATTAATAGTTTATTCATATTTGCTTGTTACACTATTTCAAAGTTAGACAAAAAGGAGTG Ogura M, et al. (2010): PE
yngABC yngA 1946188..1946247 -50:+10 GTTCATATTTTATTAATTGTTTATTCAACACTGTCCGCTATAGTAATCCATATCAACAAA Ogura M, et al. (2010): PE
ywsC-ywtABC ywsC 3700655..3700714 -50:+10 GTTACATAATGCCGATTGAGAATTCATAGTGATTCTATATACTGATGAATGAATTTACAA Ohsawa T, et al. (2009): PE
thyB-dfrA-ypkP thyB 2297915..2297981 -55:+10 ATAAAAAAATCATTTCTGGGTTCAGAAATGATTTTTTATTGTGTTACACTACTAGAAGACTACTTTT Eckart RA, et al. (2009): ND
ywfBCDEFG ywfB 3874200..3874262 -53:+10 ATCAATATTTTCAAAAAACATTGACAGTTCAATTTCCACTGGATAAAATTTACTTAAAATTTT Inaoka T, et al. (2009): PE, GS
yhdG yhdG 1023173..1023232 -50:+10 TTCTAACAATTTTGTTTTCATTTTTGCAATTTTATATATAATATTGAGTAGGAGAAAGGA Belitsky BR, et al. (2011): PE
hpr hpr 1073745..1073804 -50:+10 TATTAAAAAATTCTTACATTTTCATCTTTATTAATCTTTATTTTATTGGCATAATAGAGA Abe, S et al. (2009): PE
yvcE yvcE 3575963..3576022 -50:+10 GTAATAAAATTTATCGCTAATTTGTCGAAACTTGATGGTATAATGATTCTCGTACATAAG Bisicchia P, et al. (2007): PE
ydjM ydjM 679315..679374 -50:+10 GTAAGGATATTGAAATAAAAAATAGCTGGTTGATCGTGTATAATCTTCCTAGATGTTAAC Bisicchia P, et al. (2007): PE
yoeB yoeB 2002553..2002612 -50:+10 TTTATGCAAAAGTATTGTAATCTATCCGTAATTATTGTAACATTTGTAACATAAGAGAAA Bisicchia P, et al. (2007): PE
yjeA yjeA 1280977..1281036 -50:+10 TCCTTAAAAAGGATTGACATGAACTTCTAAATCTCATAGTATTACAAATGTGAAATAAAT Bisicchia P, et al. (2007): PE
ycdA ycdA 300674..300733 -50:+10 TAGGATGATGAACCTATTCAATATAAAAGCTAATAATCTTAAAATTAATTCCGTTGTAAC Irnov I, et al. (2010): ND
Ogura M, et al. (2012): ND
bpr bpr 1599148..1599207 -50:+10 GAATGACATGAAACGACAATATCTGTAATTCAGATTGTCTACAGTTAATATACAGCGATG Tsukahara K, et al (2008): PE
natAB natA 296352..296411 -50:+10 TCGCGACAACTTTATCCAACTAATCCAGCTTTTCGTATATAGTCATTACTAGAAATAAAG Ogura M, et al (2007): PE
yfiDE yfiD 897502..897561 -50:+10 TGTAACAAAATTACTTGACGTAAACAAGTTATGTATATATACTAGCTTACATTAAGTAAG Chi BK, et al (2010): PE
yetM yetM 790219..790278 -50:+10 TTGGCTTGGAGATGATTGACAGCTTTTCTTGGGACATAGTAAGGTAATATAGTTAGGCGC Hirooka K, et al. (2009): PE
yetL yetL 790174..790233 -50:+10 TCATCTCCAAGCCAAGTTGCGTTATGGTTTTCCCTCCTTTATAATCGTGTCACAACGAAT Hirooka K, et al. (2009): PE
yraB yraB 2755819..2755878 -50:+10 ACTTGTTTTGAGCTTGACTTAAAGTTAACTTTAAGTGTTACCTTCACAACATACAGGATA Nguyen TT, et al. (2009): 5' RACE
yraC yraC 2755903..2755962 -50:+10 TATATTCGGGACTTGCCTTAAAGCACACTTTAAACTCTATACTTCTCCATGCACTAAAAA Nguyen TT, et al. (2009): 5' RACE
yra adhA 2756189..2756248 -50:+10 TTTTAAAAAACCCTTGCCTTAAAGCAGACTTTAAGGTTTATCGTTATGTTGAAGACACCA Nguyen TT, et al. (2009): 5' RACE




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai