| Regulated Operon: | secA-prfB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| secA | ts-341 | - | 3628310..3630835 | COG0653U | secA-BAC-1 secA-BAC-2 secA-CLO secA-STR | |
| prfB | - | 3627139..3628240 | COG1186J | prfB-STR |
| Operon evidence: | Northern blotting (3.8 kb transcript) |
|---|---|
| Reference: | Herbort M, et al. (1999) |
| Comments: | A shorter 0.3 kb transcript, perhaps due to premature termination inside secA, was also detected. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -42:+11 | 3630898..3630950 | CAAATTCTTTGGAAATAACAAAAGGTATGATATGATAATGAGAGGTATACATG |
Herbort M, et al. (1999): PE RG, Western blotting |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATAAGCTGAAAAACACACCTGATGCATACGGGTGTGTTTTTTTATTTCTTAT >>>>>>>>> <<<<<<<<< |
prfB |


|