| Regulated Operon: | soj-spo0J |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| soj | spo0JA, spo0JA | - | 4205421..4206182 | chromosome partitioning protein; transcriptional regulator | soj-BAC parA-MYC soj-BAC | |
| spo0J | spo0JB, spo0JB | - | 4204580..4205428 | site-specific DNA-binding protein |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Spo0A | Negative | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCATCTTTCAAACGAAGATGGTTTTTATTTTATATG >>>>>>>> <<<<<<<< |
soj |


|