Transcription factor: Spo0A

Factor type LuxR/UhpA
SWISS-PROT ND
SubtiList ND
Consensus seq. TGTCGAA
Comment a key bi-functional regulator to control developmental transcription activities. Increases its affinity after phosphorylation (phosphorelay system). Spo0F is required for the phosphorylation. Two-domain structure. Binding consensus is called 0A box and can be located downstream of the initiation site. Often, two adjacent boxes are found. These listed sites might be viewed in its complementary strand.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
metS metS None Negative ND ND ND Molle V, et al. (2003): GS CH
rapA-phrA rapA SigA Negative ND ND ND Mueller JP & Sonenshein AL (1992): DB RG
Molle V, et al. (2003): GS CH
abrB abrB SigA Negative 45174..45201 +7:+34 ATTTTGTCGAATAATGACGAAGAAAAAT Perego M & Hoch J (1988): Genetics and Biotechnology of Bacilli, Vol. 2, pp. 129-134: RG DB
Strauch M, et al. (1990): FT
Fujita M, et al. (2005): RG GS
Molle V, et al. (2003): GS CH
dltABCDE dltA SigX Positive 3952071..3952091 +1:+21 ATGTGATTGTCGAAAAAACGG Perego M, et al. (1995): DB FT
cdd-era era None Positive ND ND ND Minkovsky N, et al. (2002): DB RG
kinA kinA SigH Negative 1469981..1470001 +13:+33 ATCTGTATATGTCGAAACACG Fujita M, et al. (1998): GS
kinC kinC SigA Positive 1518277..1518306 -30:-1 ATTATTTGTCGAAGAATGGTACAATAAGTA Kobayashi K, et al. (1995): GS FT
sinIR sinI SigA Positive 2552271..2552298 -50:-26 ACCATTCGACATCATTCTCGTTTTTTTT Shafikhani SH, et al. (2002): PE FT
spo0A spo0A SigH Positive 2518876..2518889 -18:-5 TTTGTCGAATGTAA Strauch MA, et al. (1992): FT
spo0A spo0A SigA Negative 2518953..2518987 +38:+72 AATTTCATTTTTAGTCGAAAAACAGAGAAAAACAT Strauch MA, et al. (1992): FT
spo0A spo0A SigA Negative 2519005..2519029 -5:+20 AAAAGAAGATTTTTCGACAAATTCA Strauch MA, et al. (1992): FT
spo0F spo0F SigH Positive 3810012..3810049 -84:-51 CAAAAGAGAAAATGCTCAGAAAATGTCGTAAAGTAGAC Strauch MA, et al. (1993): DP SDM FT
spo0F spo0F SigH Positive 3809913..3809955 +11:+53 TTTGACGAAAATCATAATATTGGGGTGTAAAATGATGAATGAA Strauch MA, et al. (1993): DP SDM FT
dacF-spoIIAAB-sigF spoIIAA SigH Positive 2445038..2445053 -28:-13 TCATTCCGTCGAAATC Baldus JM, et al. (1994): FT
Fujita M, et al. (2005): OV RG GS
dacF-spoIIAAB-sigF spoIIAA SigH Positive 2445058..2445076 -51:-33 TAGTTTTGTCACGGTGAAG Baldus JM, et al. (1994): FT
Fujita M, et al. (2005): OV RG GS
dacF-spoIIAAB-sigF spoIIAA SigH Positive 2445077..2445096 -71:-52 TAATTATGCCGAATGACCAC Baldus JM, et al. (1994): FT
Fujita M, et al. (2005): OV RG GS
dacF-spoIIAAB-sigF spoIIAA SigH Positive 2445091..2445122 -66:-97 CGATGGGAGACTGGACAAAATTTAAGTAATTA Baldus JM, et al. (1994): FT
Fujita M, et al. (2005): OV RG GS
spoIIE spoIIE SigA Positive 70375..70401 -134:-108 TTTTCATTTTTAGACAACATTCCGGAA York K, et al. (1992): SDM FT
Fujita M, et al. (2005): GS
spoIIE spoIIE SigA Positive 70406..70422 -103:-87 TTTTCATAAACGAATAT York K, et al. (1992): SDM FT
Fujita M, et al. (2005): GS
spoIIE spoIIE SigA Positive 70427..70443 -82:-66 GCAGAAACCGTCGAAGA York K, et al. (1992): SDM FT
Fujita M, et al. (2005): GS
spoIIE spoIIE SigA Positive 70461..70481 -48:-28 CCTTCTTTTGACAAAATCCTA York K, et al. (1992): SDM FT
Fujita M, et al. (2005): GS
spoIIGA-sigE-sigG spoIIGA SigA Positive 1603634..1603648 -100:-86 ATACTTCCTCGACAA Baldus JM, et al. (1994): SDM RO FT
Fujita M, et al. (2005): RG OV GS
spoIIGA-sigE-sigG spoIIGA SigA Positive 1603649..1603664 -85:-70 ATTAAGCAGATTTCCC Baldus JM, et al. (1994): SDM RO FT
Fujita M, et al. (2005): RG OV GS
spoIIGA-sigE-sigG spoIIGA SigA Positive 1603679..1603696 -55:-38 TTCCTCTCAACATTAATT Baldus JM, et al. (1994): SDM RO FT
Fujita M, et al. (2005): RG OV GS
spoIIGA-sigE-sigG spoIIGA SigA Positive 1603693..1603710 -41:-24 AATTGACAGACTTTCCCA Baldus JM, et al. (1994): SDM RO FT
Fujita M, et al. (2005): RG OV GS
skf ybcO SigA Positive 213824..213891 -64:+4 AATTTTTAGGATAATATACAAAATCCCCCTTACTTCGACAATTGCAATCTGGTATTATCGTATCGCAT Molle V, et al. (2003): GS CH
Fujita M, et al. (2005): RG OV, gfp fusion, GS
Chen G, et al. (2006): FT, binding site mutation
yqxM-sipW-tasA yqxM SigH Positive ND ND ND Stover AG & Driks A (1999): Western blot
Stover AG & Driks A (1999): RG
yuxH yuxH SigA Negative 3259283..3259348 -49:+17 TTTTCATGTTTAGACAATTTTCGTCAAATTATTTGATATACTTAGGGGTGAAAGCCGCGCGTATTG Fujita M, et al. (2005): RG
Molle V, et al. (2003): CH GS
sdp yvaW None Negative ND ND ND Fujita M, et al. (2005): OV RG GS
Molle V, et al. (2003): CH GS
racA ywkC SigH Positive ND ND ND Ben-Yehuda S, et al. (2003): DB RG
Wu LJ & Errington J (2003): DB Western blot
Molle V, et al. (2003): GS CH
Fujita M, et al. (2005): RG OV
yxbCD yxbC None Positive ND ND ND Molle V, et al. (2003): GS CH
yppDE yppD None Positive ND ND ND Molle V, et al. (2003): GS CH
yppF yppF None Positive ND ND ND Molle V, et al. (2003): GS CH
yttP yttP None Positive ND ND ND Molle V, et al. (2003): GS CH
yocH yocH None Positive ND ND ND Molle V, et al. (2003): GS CH
yneEF yneE None Positive ND ND ND Molle V, et al. (2003): GS CH
yfmIJ yfmI None Positive ND ND ND Molle V, et al. (2003): GS CH
yusED yusE None Positive ND ND ND Molle V, et al. (2003): GS CH
ycgMN ycgM None Positive ND ND ND Molle V, et al. (2003): GS CH
yqcGF yqcG None Positive ND ND ND Molle V, et al. (2003): GS CH
yqxIJ yqxI None Positive ND ND ND Molle V, et al. (2003): GS CH
yerBC yerB None Positive ND ND ND Molle V, et al. (2003): GS CH
accDA accD None Positive ND ND ND Molle V, et al. (2003): GS CH
ykuJK-ykzF-ykuL-ccpC ykzF None Positive ND ND ND Molle V, et al. (2003): GS CH
ykuJK-ykzF-ykuL-ccpC ykuL None Positive ND ND ND Molle V, et al. (2003): GS CH
tkt tkt None Negative ND ND ND Molle V, et al. (2003): GS CH
yqzDC yqzD None Negative ND ND ND Molle V, et al. (2003): GS CH
med-comZ med None Negative ND ND ND Molle V, et al. (2003): GS CH
yrrL yrrL None Negative ND ND ND Molle V, et al. (2003): GS CH
ftsEX ftsE None Negative ND ND ND Molle V, et al. (2003): GS CH
fla-che flgB None Negative ND ND ND Molle V, et al. (2003): GS CH
lytE lytE None Negative ND ND ND Molle V, et al. (2003): GS CH
ykaA-pit ykaA None Negative ND ND ND Molle V, et al. (2003): GS CH
fruRKA fruR None Negative ND ND ND Molle V, et al. (2003): GS CH
cotD cotD None Negative ND ND ND Molle V, et al. (2003): GS CH
divIVA divIVA None Negative ND ND ND Molle V, et al. (2003): GS CH
rocDEF rocD None Negative ND ND ND Molle V, et al. (2003): GS CH
yvyE-yvhJ yvyE None Negative ND ND ND Molle V, et al. (2003): GS CH
nfrA-ywcH nfrA None Negative ND ND ND Molle V, et al. (2003): GS CH
nfrA-ywcH ywcH None Negative ND ND ND Molle V, et al. (2003): GS CH
soj-spo0J soj None Negative ND ND ND Molle V, et al. (2003): GS CH
rok rok None Negative ND ND ND Molle V, et al. (2003): GS CH
dnaAN dnaA None Negative ND ND ND Molle V, et al. (2003): GS CH
yqxD-dnaG-sigA dnaG None Negative ND ND ND Molle V, et al. (2003): GS CH
yaaDE yaaD None Negative ND ND ND Molle V, et al. (2003): GS CH
ylmDEFGH ylmD None Negative ND ND ND Molle V, et al. (2003): GS CH
comK comK None None ND ND ND Molle V, et al. (2003): GS CH
yvyD yvyD None None ND ND ND Molle V, et al. (2003): GS CH
spoIID spoIID None None ND ND ND Molle V, et al. (2003): GS CH
veg veg None None ND ND ND Molle V, et al. (2003): GS CH
ygaO ygaO None None ND ND ND Molle V, et al. (2003): GS CH
yjcPQ yjcP None None ND ND ND Molle V, et al. (2003): GS CH
rocG rocG None None ND ND ND Molle V, et al. (2003): GS CH
ywqCD ywqC None None ND ND ND Molle V, et al. (2003): GS CH




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai