| Regulated Operon: | tetLB | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups | 
|---|---|---|---|---|---|---|
| tetL | - | 4189091..4189153 | ||||
| tetB | tetA(L) | - | 4187681..4189057 | COG2814G | 
| Operon evidence: | Northern blotting | 
|---|---|
| Reference: | BSORF | 
| Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter in front of tetB | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigA | Promoter | -45:+18 | 4189159..4189221 | AAAGTAAAAGTTTAATCCTTAGTCTATATATAATAAGATCATATCAATCAAATGTAGGGGGAG | Sakaguchi R, et al. (1988): S1 | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| TGAAAGGATCAATCTTGTGAAAGTAATTCAAGGTTGATCCTTTTTTGTAAAATGA >>>>>>>>>>>>>>>>> <<<<<<<<<<<<<< | tetB | 


| 
 |