| Regulated Operon: | thrS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| thrS | - | 2959257..2961188 | COG0441J | thrS-BAC thrS-LAB thrS-STA thrZ-BAC |
| Operon evidence: | Northern blotting (2.3 kb transcript) |
|---|---|
| Reference: | Putzer H, et al. (1992), Grundy FJ & Henkin TM (1993), Wipat A, et al. (1996) |
| Comments: | Runoff transcription, Northern blotting, and S1 nuclease mapping also showed a 280 bp transcript, presumably due to transcriptional termination at the stem-loop in front of thrS caused by binding of uncharged tRNA-Thr to the T-box sequence motif. The tRNA anticodon binds to the ACC codon in the sequence UUUACCGCC in the thrS leader mRNA. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -42:+20 | 2961475..2961536 | GCGATCGTGTTGATTTTTTGGATTGAACAATTTATAATACATAGGAGATTAAGAAAGACACA |
Gendron N, et al. (1994): PE RO |
| TrnI-Thr | Positive | ND | 2961251..2961285 | TTTGCGGAAAAAAGGGTGGAACCACGATTCCGTTT |
Putzer H, et al. (1992): RG SDM, Western blot Gendron N, et al. (1994): RO OV RG DP NB Putzer H, et al. (1995): DP RG SDM Putzer H, et al. (2002): RO RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATTCCGTTTATTCAACCTCGTCCCTTTCATAGGGGGCGGGGTTTTTATATGCAAAA >>>>>>>>>> <<<<<<<<<< |
thrS | |||
| AAAAAGCATGATCTCATTGAAGAGATCATGCTTTTTTTATTTCTCT >>>>>>>>>> <<<<<<<<<< |
thrS |


|