| Regulated Operon: | tlpC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| tlpC | - | 372771..374492 | COG0840NT |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Van Sinderen D, et al. (1995), Hanlon DW, et al. (1994) |
| Comments: | Hanlon was not able to locate an obvious transcriptional terminator after tlpC, but notes that tlpC is probably monocistronic as the downstream gene nucA is specific for competence. The terminator proposed by Van Sinderen et al. lacks a T-stretch. BSORF does not contain a Northern blotting result for tlpC. The nucA-nin transcripts listed in BSORF start downstream of tlpC. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigD | Promoter | ND | 374513..374560 | CTAAAATAAAACTTTAAACCCAAAAACCCGATAAGTAATATGACCTGC |
Hanlon DW, et al. (1994): HM SDS-PAGE |


|