Transcription factor: SigD

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TAAA(-35)-N15-GCCGATAT(-10)
Comment RNA polymerase Sigma-28 factor (Sigma D). Autolytic enzymes; defect in flagellar synthesis.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
cheV cheV 1473532..1473580 -41:+8 GCTGCCATTCACTTTTTACAAATTACGCCGATATATACAGTACAATACT Fredrick KL & Helmann JD (1994): PE DB RG, in-vitro transcription
degR degR 2308396..2308444 -41:+8 CAAAATAGAAAAGAAAATAAAAATAAGCCGATATAACTATTGAACCAGA Helmann JD, et al. (1988): Genetics and Biotechnology of Bacilli, Vol. 2, pp. 189-193: in-vitro transcription
Ogura M, et al. (1996): RG DB PE
dltABCDE dltA 3951975..3952022 None ATAAAGATTCATTTTCAAAAACATACGCCGATATATTAATTTGAGGGA Perego M, et al. (1995): DB RG
epr epr 3939798..3939848 -43:+8 CCTTCTTACTATTAATCTCTCTTTTTTTCTCCGATATATATATCAAACATC Dixit M, et al. (2002): PE
fla-che flgB 1691011..1691062 -41:+11 CATTTTTCTTCAAAAAGTTTCAAAAATGCCGAAAAGAAAGGAGAAAAAACAG Gilman MZ, et al. (1984): RNA probes
Estacio W, et al. (1998): PE
hag hag 3635988..3636033 -40:+6 TTTTGTATTAACAAAATCAGAGACAATCCGATATTAATGATGTAGC Mirel DB & Chamberlin MJ (1989): PE DB NB
lytABC lytA 3663103..3663151 -42:+7 TTTTTCTTTAAAATATAAAATAGGTTGACGATAAAATATAATGAGGTGA Lazarevic V, et al. (1992): PE DB
Kuroda A & Sekiguchi J (1993): PE RG
lytD lytD 3687498..3687547 -41:+9 TTCACCTATAAATGAAGCATGCGCGTGCCGATAAATAAACTAGTTTTATA Rashid MH, et al. (1995): DB, SDS-PAGE
Margot P, et al. (1994): PE DB
lytF lytF 1013291..1013344 -42:+12 TAAAAAGGCAAAACGATGAGACAAATGTGCCGATATAAAAAAGAAACAGCAAAT Margot P, et al. (1999): DB SDS-PAGE
Ohnishi R, et al. (1999): PE DB NB
tlpA-mcpA mcpA 3208170..3208221 None TTTTGCTGTATATATTTACCCATTTCCAGCCGATATGAAGGGTAGCATAAAA Hanlon DW & Ordal GW (1994): HM
mcpB mcpB 3212454..3212497 None TTTTATTTTAAAACTTTTTTAAGCAGCCGATATATACTGTATCA Hanlon DW & Ordal GW (1994): HM
mcpC mcpC 1463571..1463622 -43:+9 TTTGATTATTCATTTTTCAAACGAAAGGGCCGATATAGAAATTAGGAGGGGA Muller J, et al. (1997): PE DB RG
motAB motA 1435275..1435321 -42:+5 AATGTCCCTAAAGTTCCGGGCACCAAAACCGATATTAACCATAGACA Gilman MZ, et al. (1981): S1 RO, in-vitro transcription
Gilman MZ & Chamberlin ML (1982): S1
nfrA-ywcH nfrA 3912241..3912286 -41:+5 TTTCACTTTTGAGATCACTTTTTTTCGGATATGATAAAAAGTGATA Moch C, et al. (1998): PE SDM HM
yqxD-dnaG-sigA sigA 2601522..2601574 None CTTCTTTGGCTCAAGAAATCGTTACATTGAACCGATCTTTAAAATAACTGGAG Wang LF, et al. (1985): HM
Briat JF, et al. (1985): S1
tlpA-mcpA tlpA 3210289..3210337 None TTTCAATGTAATTTAAAGGAAGATCCGCCGATATAATTTGTAAATTATT Hanlon DW & Ordal GW (1994): HM
tlpB tlpB 3206076..3206122 None TTTTTTATTAAACCTTTTATCCTAGTTTGACGATATTAGATTTATCT Hanlon DW & Ordal GW (1994): HM
tlpC tlpC 374513..374560 None CTAAAATAAAACTTTAAACCCAAAAACCCGATAAGTAATATGACCTGC Hanlon DW, et al. (1994): HM SDS-PAGE
ybdO ybdO 224994..225048 None TTTGAGGTTAATATATACATTATATTCGCCGATAAAAAAGAATAAGAGAGAATAC Serizawa M, et al. (2004): AR NB
yfmTS yfmT 807027..807081 None TGAACCGATAGAAAAAATAGATTCGCCCATATTTTGATTTGCGGTTATAAAGGAG Serizawa M, et al. (2004): AR NB
hemAT hemAT 1113969..1114017 None TCTGCAGCTTCATTCATGTTTCCCTTGGCCGATAAAAAAGAAAAAGGCT Serizawa M, et al. (2004): AR NB
yjbJ yjbJ 1235751..1235803 None GCCCGCTTTCAAGTTTCAGTTCTTTGCTCAGCCAATATACAAACGGTCTGACA Serizawa M, et al. (2004): Master's thesis, Rho Ohnishi, Shinshu University
yjcPQ yjcP 1266556..1266603 None CAAATTGTTAATCGATAACTTTTCATTCCCGATATTAAAAATGGGAGT Serizawa M, et al. (2004): AR NB
yjfB yjfB 1283342..1283391 None TTTCACTGTAAAATCATACAAACCCGCCGATAGGTAAGGCATAGGAGGTG Serizawa M, et al. (2004): AR NB
ylqB ylqB 1671669..1671718 None AAATACGCTAAATATCATCCAATTTATTCCGATATTGTATATGAACCCTA Serizawa M, et al. (2004): AR NB
yoaH yoaH 2031192..2031238 None TATCACTATAAAACTTGATAACACGTGTCGATATTATGGACATGAGC Serizawa M, et al. (2004): AR NB
yscB yscB 2953735..2953791 None AAGAAATGTAAAACAAAGTTAATCTCTGACCGATATAAGGAGCAGAAGGGAGCCTGA Serizawa M, et al. (2004): AR NB
yvyC-fliDST yvyC 3634775..3634819 -41:+4 ATATGTGTAATCTTATCTCGACTTAGTCGATATAAACGATAGATT Chen L & Helmann JD (1994): RG DB
Singer V (1987): Ph.D. thesis. University of California, Berkeley: PE?
comFABC-yvyF-flgM-yvyG-flgKL yvyF 3641089..3641133 -40:+5 AGAAGCTAAATGATTCTGTTTTTATGCCGATATAATCACTAGAAA Gilman MZ, et al. (1981): S1 RO, in-vitro transcription
Gilman MZ & Chamberlin ML (1982): S1
Mirel DB, et al. (1994): RO
yxkC yxkC 3989157..3989206 None ATATTGACTAAGAGAAATAATATAGGCATTATAGTACATATGTTTCGTAC Serizawa M, et al. (2004): AR NB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai