| Regulated Operon: | tnrA | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups | 
|---|---|---|---|---|---|---|
| tnrA | scgR | - | 1397411..1397743 | COG0789K | tnrA-BAC | 
| Operon evidence: | upstream and downstream genes are on the opposite strand | 
|---|---|
| Reference: | Genbank U55004 | 
| Comments: | 
| Binding factor  | 
  Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| TnrA | Positive | ND | 1397808..1397824 | TGTTAGAAAATATGACA | 
  Robichon D, et al. (2000): DE DP | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol]  | 
  Downstream of | 
|---|---|---|---|---|
| TAAAAGTCCGGCTCGCAGTTGAGACGGACTTTTTACGTTTATAA >>>>>>>>> <<<<<<<<<  | 
  tnrA | 


  |