Transcription factor: TnrA

Factor type MerR family
SWISS-PROT ND
SubtiList ND
Consensus seq. TGTNA-------TNACA
Comment Positively regulates many genes for degrading nitrogen-containing compounds but negatively regulates glnR. Binds to the same sequence with GlnR (repressor)
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
alsT alsT None Negative 1938864..1938880 None TGTTAAAAAATCTAACA Yoshida K, et al. (2003): AR HM GS
citB citB SigA Positive ND ND ND Blencke HM, et al. (2006): RG
degSU degU SigA Negative 3645439..3645455 -57..-41 TGGAAGGAACGATGACA Yasumura A, et al. (2008): RG NB DP DB SDM
gabP gabP SigA Positive 686651..686667 -60:-44 TGGTATATTTTCTTACA Ferson AE, et al. (1996): DB DP
glnQHMP glnQ None Positive 2801879..2801895 None GGGTATATTTTCTGACA Yoshida K, et al. (2003): AR HM GS
glnRA glnR SigA Negative 1877877..1877893 -58:-42 TGTTAAGAATCCTTACA Wray LV Jr, et al. (1996): DB
glnRA glnR SigA Negative 1877900..1877916 -35:-19 TGACACATAATATAACA Wray LV Jr, et al. (1996): DB
gltAB gltA SigA Negative 2014663..2014688 +1:+26 AGAGTTGTTAGATTTTATGACCGGTA Belitsky BR, et al. (2000): FT
Yoshida K, et al. (2003): AR HM GS
ilvBHC-leuABCD ilvB SigA Negative 2897632..2897681 -210:-193 CATATACGAACCATATCGTGTTATAAAATCTTCCATGTTTATATAAAATT Tojo S, et al. (2004): FT
nasA nasA SigA Positive 362838..362856 -58:-42 GTGTCACAAAAACTTACAC Nakano MM, et al. (1995): DP SDM
Yoshida K, et al. (2003): AR HM GS
nasBCDEF nasB SigA Positive 362838..362856 -58:-42 GTGTAAGTTTTTGTGACAC Nakano MM, et al. (1995): DP SDM
Yoshida K, et al. (2003): AR HM GS
nasBCDEF nasD None Positive 358250..358266 -55:-39 TGTTACATTTTATAACA Nakano MM, et al. (1998): RG DB
Yoshida K, et al. (2003): AR HM GS
nrgAB nrgA SigA Positive 3756688..3756704 -57:-41 TGTCAGGAAATCTTACA Wray LV Jr, et al. (1996): RG DB
Yoshida K, et al. (2003): AR HM GS
oppABCDF oppA None Positive 1219618..1219634 None TGGAAGAAAAACTAACG Yoshida K, et al. (2003): AR HM GS
pel pel None Negative 827950..827966 None TGGAATAAAATCTCACA Yoshida K, et al. (2003): AR HM GS
ptb-bcd-buk-lpdV-bkdAABB ptb SigL Negative ND ND ND Debarbouille M, et al. (1999): RG
pucRJKLM pucJ SigA Positive 3330362..3330378 -113:-97 TGTTACATTTTCTTACA Yoshida K, et al. (2003): AR HM GS
tnrA tnrA None Positive 1397808..1397824 None TGTTAGAAAATATGACA Robichon D, et al. (2000): DE DP
yccC yccC SigA Positive 290828..290851 -60:-37 TACTGAGAGAAAAGCTGACTGATC Fisher SH & Wray LV Jr (2002): FT GS
ycsFGI-kipIAR-ycsK ycsF None Positive ND ND ND Wang L, et al. (1997): DB
ykzB-ykoL ykzB None Positive 1397851..1397867 -57:-41 CGGAAGAAAAATTAACA Robichon D, et al. (2000): PE DB DP
yodF yodF None Negative 2130116..2130132 None TGTGATCTTTTCTTACA Yoshida K, et al. (2003): AR HM GS
yttA yttA None Negative 3108551..3108567 None CGTGAAAAAATCTAACA Yoshida K, et al. (2003): AR HM GS
ywdIJK ywdI None Negative 3896198..3896214 None TGTCAGAAAAAATAACA Yoshida K, et al. (2003): AR HM GS
ywlFG ywlF None Negative 3791786..3791802 None TGTCAGAAAATCTGCAA Yoshida K, et al. (2003): AR HM GS
ywrD ywrD None Positive 3720778..3720794 None CGTCAGTTTTTCTGCCG Yoshida K, et al. (2003): AR HM GS
yxkC yxkC SigD Negative 3989201..3989217 None TCGTACATTTTATTACA Yoshida K, et al. (2003): AR HM GS
yycCB yycC None Negative 4159511..4159527 None TGTGACATCTTCTTACA Yoshida K, et al. (2003): AR HM GS




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai