| Regulated Operon: | trpEDCFBA-hisC-tyrA-aroE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| trpE | - | 2375869..2377416 | COG0147EH | x1522-STA | ||
| trpD | - | 2374881..2375897 | COG0547E | |||
| trpC | - | 2374139..2374888 | COG0134E | |||
| trpF | - | 2373487..2374134 | COG0135E | |||
| trpB | - | 2372304..2373506 | COG0133E | |||
| trpA | - | 2371508..2372311 | COG0159E | |||
| hisC | aroJ | - | 2370415..2371497 | COG0079E | x1197-BAC x1361-STA x1594-BAC | |
| tyrA | - | 2369251..2370366 | COG0287E | tyrA-STA | ||
| aroE | - | 2367954..2369240 | COG0128E | aroE-BAC aroE-STA |
| Operon evidence: | integrative plasmids to interrupt transcription |
|---|---|
| Reference: | Shimotsu H & Henner DJ (1984), Henner DJ, et al. (1985), Henner DJ, et al. (1986), Shimotsu H, et al. (1986), Babitzke P & Gollnick P (2001) |
| Comments: | Transcription starting from the promoter in front of aroF leads to an aroFBH-trpEDCFVA-hisC-tyrA-aroE transcript and an aroFBH transcript, terminating at the terminator/antiterminator structure in front of trpE, as shown by Northern blotting, 3' S1 nuclease mapping, promoter deletions, site-directed mutagenesis, and reporter gene fusions. Readthrough transcription takes place under tryptophan limitation. The MtrB product (TRAP) causes both transcriptional and translational attenuation. In case of transcriptional attenuation, termination occurs at the GT in the T-stretch TTTATTTGT. NusA stimulates transcriptional pausing and termination. Translational attenuation may be followed by transcriptional attenuation further downstream: The absence of the ribosome allows access of the Rho protein to the nascent mRNA transcript, resulting in Rho-dependent transcriptional termination. An internal promoter may exist upstream of hisC. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CATTATGTTTATTCTACCCAAAAGAAGTCTTTCTTTTGGGTTTATTTGTTATATA >>>>>>>>>> <<<<<<<<<< |
trpE | |||
| AAAAATCCTGAAGTTTTACTTCAGGATTTTTTATGCAGATC >>>>>>>>> <<<<<<<<< |
aroE |


|