| Regulated Operon: | tuaABCDEFGH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| tuaA | yvhA, yvhA | - | 3657383..3657922 | |||
| tuaB | yvhB | - | 3656752..3658203 | COG2244R | ||
| tuaC | yvhC | - | 3655586..3656755 | COG0438M | ||
| tuaD | yvhD | - | 3654139..3655524 | COG1004M | ||
| tuaE | yvhE | - | 3652588..3654054 | |||
| tuaF | yvhF | - | 3651879..3652559 | |||
| tuaG | yvhG | - | 3651097..3651855 | COG0463M | ||
| tuaH | yvhH | - | 3649875..3651068 | COG0438M |
| Operon evidence: | Northern blotting (9.0 kb transcript); transcriptional fusions to tuaD and tuaH |
|---|---|
| Reference: | Lahooti M & Harwood CR (1999), Soldo B, et al. (1999), Genbank AF015609 |
| Comments: | several smaller mRNA molecules were also detected; these may be prematurely terminated transcripts or processed products. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| PhoP | Positive | -62:-18 | 3658953..3658997 | ATTCACACTTCTTAACATACCATTTACATCCAATTAACATCCGTC |
Liu W, et al. (1998): DB GS FT Soldo B, et al. (1999): PE RG Allenby NE, et al. (2005): DB AR |
| SigA | Promoter | -44:+6 | 3658932..3658981 | ATACCATTTACATCCAATTAACATCCGTCTGCTAAACTGACTGGCATAGG |
Soldo B, et al. (1999): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AACATGCGTAGTCCTATAAATTGGGATGCGCGTTTTTTGATTATACG >>>>>>>>>>> <<<<<<<<<< |
tuaH |


|