 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | txpA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yqdB | txpA, yqcR | + | 2678240..2678419 |
| Operon evidence: | Northern blotting (275 nt transcript) |
|---|---|
| Reference: | Silvaggi JM, et al. (2006) |
| Comments: | The antitoxin RatA (for RNA antitoxin A) is a small (222 nucleotides), untranslated RNA that blocks the accumulation of the mRNA for the toxic peptide TxpA (for toxic peptide A; formerly YqdB). |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -50:+11 | 2678145..2678205 | TCATACTTTTTGAATGTGCTTTCCATATAATTCATGTATAATAGATTCTTGAAGCTACCTT |
Silvaggi JM, et al. (2005): PE NB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGAGGACCCTCCTATTAAAGGGTAGTTTCTTTTTTAAAAG >>>>> <<<<< |
yqdB |
|