 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yacLMN |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yacL | + | 108674..109774 | COG4956R | yacL-BAC | ||
| yacM | + | 109789..110487 | COG1211I | |||
| yacN | + | 110480..110956 | COG0245I |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Petersohn A, et al. (1999) |
| Comments: | Northern blotting results in BSORF show several transcripts in the radA-yacKLMN region, some terminating at yacM and others at yacN. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -39:+3 | 108559..108600 | TTTCGGTTAAAACCTTATGAATACGGGTATATTAATGTTGGT |
Petersohn A, et al. (1999): HB PE |
|