Transcription factor: SigB

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. AGGTTT(-35)-N17-GGGTAT(-10)
Comment RNA Polymerase Sigma-37 Factor (Sigma-B). General stress factor sigma.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
aldY aldY 3986362..3986402 None ATTCGTTTACATATTGGCTTCAGCGGAAATAGAAGAAGACA Petersohn A, et al. (1999): HB
bmrU-bmr-bmrR bmrU 2493595..2493638 -40:+4 TCTTCGTTTACTGCTTACAGAAAAAGGGGATTATATAACCAGAA Petersohn A, et al. (1999): PE RG
cdd-era cdd 2611373..2611426 -48:+6 TTTTTAGAAATGGGCGTGAAAAAAAGCGCGCGATTATGTAAAATATAAAGTGAT Wang LF, et al. (1984): S1 RO
Song BH & Neuhard J (1989): HM
clpP clpP 3546087..3546150 -45:+19 CATACGATGGTTTGAACCCCTGTATTTTTGGGGAAAATGGGAAAAAGAGACGACTTTGCATATC Gerth U, et al. (1998): PE DB HM
Voelker U, et al. (1994): 2D PAGE
csbA csbA 3615427..3615469 -40:+3 ATGGTGATTGATTTTGGCTGAAAAGGGGTATGGTGTAAGTAGA Boylan SA, et al. (1991): PE DB RG
csbB csbB 930710..930755 -43:+3 AAAAAACAGGTTTAAACGACTTTAAAAAAAGGAATAGCCTTACTGA Akbar S & Price CW (1996): RG
Huang X & Helmann JD (1998): PE RG
csbC csbC 4087895..4087949 None TTTTCAAAACAAATGTTTCAAATGAGATAGGAAATGGGTACTAATCTATTAACTT Akbar S, et al. (1999): RG; binding site mutation
ywmF-csbD csbD 3770314..3770367 None TAACATTAGAATGTTTATTGCCTCTCAGATCGGGAAGTTAACAAGTACACACAT Akbar S, et al. (1999): RG; binding site mutation
csbX-bofC csbX 2838793..2838852 -50:+10 TTTTAATCTAACAGGATTACAATTCAGCAAGCTTGGGTATATACTCCATTGATACTTTAA Gomez M & Cutting SM (1997): PE
gcaD-prs-ctc ctc 58708..58749 -40:+2 CGAGGTTTAAATCCTTATCGTTATGGGTATTGTTTGTAATAG Ollington JF, et al. (1981): NB DP RO, in-vitro transcription
Moran CP Jr, et al. (1981): FT S1 RO, dinucleotide priming
Tatti KM & Moran CP Jr (1984): RO SDM
Igo MM & Losick R (1986): RG NB DP
Boylan SA, et al. (1993): RG
Voelker U, et al. (1994): 2D PAGE, HB
Petersohn A, et al. (1999): HB
ctsR-mcsAB-clpC-radA-yacK ctsR 101314..101365 -46:+6 ATCAGCAATCAGGTTTTGTGGACCGGGAAAATGGAAATAATGAAGGATAGAG Kruger E, et al. (1996): NB PE
dps dps 3136692..3136735 -41:+3 AAGAGGTTTTAGCGTACGATATTAAGGGTATACATAGTCATATA Antelmann H, et al. (1997): 2D-PAGE, NB PE DB
gsiB gsiB 494441..494482 -38:+4 TGTTTGTTTAAAAGAATTGTGAGCGGGAATACAACAACCAAC Maul B, et al. (1995): HB PE DB
Mueller JP, et al. (1992): PE RG NB
Voelker U, et al. (1994): 2D PAGE, HB
gspA gspA 3945444..3945482 -37:+2 ACGTGTTTATTTTTTTGAAAAAGGGTATGTAACTTGTAC Antelmann H, et al. (1995): PE HB DB NB
Petersohn A, et al. (1999): HB
gtaB gtaB 3665544..3665586 -40:+3 AAAATGTGTAAAAACATATTGAAAAGGGTAAATAGAGAATAGT Varon D, et al. (1993): PE DB
katE-yxiS katE 4010232..4010275 -40:+4 TAGCAGTTTATATGAAGAACGCCACGGGTAAATGTGCTGTAGAA Engelmann S, et al. (1995): HB NB DB PE
katX katX 3964926..3964979 -47:+7 AAAAAAACGGCTGTTTTAAAATCTTTCCATTCAGGGAATATTGTTACCGTTCAA Petersohn A, et al. (1999): NB PE DB 2D-PAGE
nadE nadE 338213..338263 -42:+9 ACAGTCATGATTCATTTTCATTGATTTAGGGAAATGATCAGTAATAAGGGA Antelmann H, et al. (1997): NB PE
opuE opuE 728438..728482 -38:+7 CAATGTTTCATCGCTTGAATGGCCGGGAATACTTTGTTAGGTTAA Von Blohn C, et al. (1997): PE DB
Spiegelhalter F & Bremer E (1998): NB RG DP SDM
phoPR phoP 2978538..2978583 -38:+8 GTTAAGATGACATAAAATAGAGAAATAGGATGTCGGGGAATTATAA Paul S, et al. (2004): PE, In-vitro reconstitution, DB (unclear result)
relA-yrvI relA 2822803..2822846 -40:+4 TTTGCATTTATTTTATATAATATTTGGCTATTTGAACTTCTGCT Wendrich TM, et al. (1997): PE
rsbRSTUVW-sigB-rsbX rsbV 522016..522058 -40:+3 GAAAGGTTTAACGTCTGTCAGACGAGGGTATAAAGCAACTAGT Kalman S, et al. (1990): PE S1 DB RG
Boylan SA, et al. (1993): PE; Western blot; RG
Voelker U, et al. (1994): 2D PAGE, HB
trxA trxA 2913580..2913621 -40:+2 TCAGGTTTTAAAACAGCTCCGGCAGGGCATGGTAAAGTACAT Scharf C, et al. (1998): PE, 2D-gel
Petersohn A, et al. (1999): HB
yacLMN yacL 108559..108600 -39:+3 TTTCGGTTAAAACCTTATGAATACGGGTATATTAATGTTGGT Petersohn A, et al. (1999): HB PE
gabTD gabD 442756..442796 -37:+4 AACGGATTACTTTTGCTGACAGCGGGAATTAACGGTAATAT Petersohn A, et al. (1999): HB PE
ydaDEFG ydaD 471639..471683 -40:+5 AGCCATGTTTATCCAAAGAGTGTGTGAGGTACACAACAAATAGAC Petersohn A, et al. (1999): PE NB 2D-gel
ydaDEFG ydaG 473739..473778 -36:+4 TTGTTTAAATCTTCCCCGGATGTGGAAAAGTAACAGCGGA Petersohn A, et al. (1999): PE NB 2D-gel
ydaP ydaP 488772..488814 -39:+4 TCCGGGTTTTAAAGCCTTTCTCCTGTGGTATTGAAAAAAGGAA Petersohn A, et al. (1999): PE NB 2D-gel
ydaTS ydaS 492933..492974 None AAGTGTTTCGAAATGATCAGGAGCGGTTATTGATTGGTAAAT Petersohn A, et al. (1999): HB
ydaTS ydaT 493461..493501 None ATGCGTTTTTATTTTTCACCTGCGGGTACCATTTTTATAAA Petersohn A, et al. (1999): HB
dctB-ydbD ydbD 496582..496627 -41:+5 GTTTTTCGTTTATCTTTCTATCGATCGGAAATATAAAAAGAGATAA Price CW, et al. (2001): RACE-PCR DB
ydbP ydbP 508267..508311 None CTTTGATTACAGCCAGAGCTGTCTGCAGGGAAACATTATGTTCTG Petersohn A, et al. (1999): HB
mhqNOP ydfO 596815..596864 -45:+5 AAGACACCGTTTCGTTTTATGAAAACAGGGGAGAACAATTTAAGAGAGAT Price CW, et al. (2001): RACE-PCR DB
ydhK ydhK 624374..624415 None TTATGTTTGGCTTTGCAAACAAAGGGGAATAGGACAAACTGC Petersohn A, et al. (1999): HB
yfhKLM yfhK 928733..928775 None ACATGTTTCACCAGCCTGTCAATCAGGGAATACCACTTATATC Antelmann H, et al. (2000): HB
yfkJIH yfkJ 861948..862000 -44:+9 TTCATGAAGGTTTCTTTTTAGAGAAATAGGGGCAAAGAATAGGGAGGTTGCAC Price CW, et al. (2001): RACE-PCR DB
yflA yflA 844711..844752 -37:+5 AAAGGTTTATGTTTTTCCATCTATGGGAAATGATTCATAAAC Petersohn A, et al. (1999): HB PE
yhdF yhdF 1022165..1022206 -38:+4 TGGCGTTTATTCATTTCTGTCGTGTGGTAACGTTCAGTATCA Petersohn A, et al. (1999): HB PE
yhdNO yhdN 1030207..1030246 None AAGGTTTAACATTTTTTCCAGAGGGGAAAAGATAGTGAAA Petersohn A, et al. (1999): NB 2D-gel HB
nhaX nhaX ND ND ND Pragai Z, et al. (2002): RG
yjbCD yjbC 1226864..1226911 -42:+6 TAAGGCTGTTTAAACAAGAAGAAATGGGGTATATCTAAAAGTATGAAG Petersohn A, et al. (1999): PE HB
Antelmann H, et al. (2000): PE NB
yjgB yjgB 1285465..1285505 None ACATGTTTCGTTGCAAAAACACGGGGAAACGGAATGGTAGA Petersohn A, et al. (1999): HB
ykgAB ykgA 1371901..1371943 None AATGGTTTAATGATTTTCATGATGAGGGAATAATAAATGTATT Petersohn A, et al. (1999): HB
ohrB ykzA 1381943..1381998 -51:+5 CTCGGCAAACATAGCATGTTTAAAAAGATCAGAAAGGGAAATATAACAACTAGATA Volker U, et al. (1998): PE HM
yocK yocK 2097629..2097678 None CGATGTTTCCATGTTTGACAGAAGGCAAAACGGGAAACAGGATAGAAAGG Petersohn A, et al. (1999): NB 2D-gel HB
yotK yotK 2153415..2153457 None TCTAGTTTCTCTTTTTAAAAGAGTAGGGTATTGCAAACAACAG Petersohn A, et al. (1999): HB
yoxA-dacC yoxA 2000891..2000931 None AACGGTGTTTTTTTATTTGATAGGGGAAAATATAAAATGGA Petersohn A, et al. (1999): HB
yoxCB-yoaA yoxC 2019368..2019408 None TTCTGATTAAAAAAACGGATACAGGGTAATGACATAAGAAA Petersohn A, et al. (1999): HB
ypuBC ypuB 2434368..2434409 None TGCTGATTATACAAAAAGTGGATTGGGAATGATAAAAGAACA Petersohn A, et al. (1999): HB
yqgZ yqgZ 2564427..2564482 -47:+9 CTGTAAATGGTTTAAATGAAAAATGATCCGGGTAGTTATTCTACAAAGAGATGGTT Price CW, et al. (2001): RACE-PCR DB
yqhA yqhA 2563939..2563983 None TTCGGTTTTTCACCTGTTCAGAAACTGGGCTAGCTGGATTCGAAC Petersohn A, et al. (1999): HB
yqhQP yqhQ 2540891..2540932 None CTGCGAGTAAAATTTGAAAATAACGGGTATAATGCATGTAGA Petersohn A, et al. (1999): HB
yqxD-dnaG-sigA yqxD 2604059..2604107 -41:+8 ATCCTGGGTTTTTGGCTGTGCCAAAAGGGAATAATGAAAAACAATAGCA Liao CT, et al. (1999): PE
yqxL yqxL 2561468..2561508 None ACTGGTTTAGTGACGCGGTTATTGGGCAATTAAAGAATAAA Petersohn A, et al. (1999): HB
yrvD yrvD 2826191..2826232 None CCATGTTTAAAACCAGTCTTGATTGGGAAAGTTACCTCAATA Petersohn A, et al. (1999): HB
ysnF ysnF ND ND ND Pragai Z, et al. (2002): RG
ytkL ytkL 3010623..3010664 None ATAAGTTTTTCAGCTTTTTAAAAAGGGAAAATAAAAAAAACA Petersohn A, et al. (1999): HB
ytxGHJ ytxG 3048037..3048082 -41:+5 AGTACACATGTTTATGATTGAAGAAAACGGGTAAACAGCAGTATAT Varon D, et al. (1996): PE DB RG, plasmid integration
yvgO yvgO ND ND ND Pragai Z, et al. (2002): RG
yvrE yvrE 3406567..3406607 None AGTGGTTTGGACACCTCTTTGCCGGGAATAACAATATATAG Petersohn A, et al. (1999): HB
yvyD yvyD 3631602..3631650 -42:+7 GATTTATGTTTCAGCAGGAATTGTAAAGGGTAAAAGAGAAATAGATACA Drzewiecki K, et al. (1998): PE NB DB
Eymann C & Hecker M (2001): PE
ywjC ywjC 3818832..3818883 -44:+8 AAAAATAGGTTTACGACTTGTCAGCTTTGGGAACTTAGGCTATATAAGACAA Price CW, et al. (2001): RACE-PCR DB
ywmE ywmE 3774568..3774621 -48:+6 TTTTTTATTGGTTTAAAAACAGTTTGGGCGGGAATGATACCCTAAAAAGGGGTT Price CW, et al. (2001): RACE-PCR DB
ywtG ywtG 3693951..3694003 -49:+4 TAAAAAGGTTTAATGGCCGGAAAAAGAGGCTAAAAGATTTCTAAAAAAATCCC Price CW, et al. (2001): RACE-PCR DB
yxaAB yxaB 4112012..4112070 -48:+11 GATGCACATGCCAATGCATAGCCATCCTTCTTTTTGGGTAGAGACAGTTAACACACAAT Nagorska K, et al. (2008): 5' RACE, DB RG
yxkO yxkO 3973298..3973339 None TTTTGTTTGAAAAAGAAAAGGGACAGGAAAAATAGGAAAAGA Petersohn A, et al. (1999): HB
yycD yycD 4158944..4158985 None GATCGTTTCGGACAGTAACAAGGCGGGAAAAATGCAATAAAA Petersohn A, et al. (1999): HB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai