Regulated Operon: ybbB

Genes
Genes Synonyms Direction Genome position Function COG ID Conserved groups
ybbB yzbC - 183414..185003
COG0614P  

Operon evidence: Genome analysis
Reference: Baichoo N, et al. (2002)
Comments:


Promoters

Binding
factor
Regulation Location Absolute position Binding seq.(cis-element) Experimental evidence
Fur Negative ND 185018..185067 TATTTGGTACAATTTTTATTGAAAATGATTATCAATTGAAAGCTTCTGAA Baichoo N, et al. (2002): FT

Terminator

No Data

Overview



Upper Region






Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai