Transcription factor: Fur

Factor type Fur family
SWISS-PROT ND
SubtiList ND
Consensus seq. GATAATGATAATCATTATC
Comment negative regulation of siderophore biosynthesis and transcription of ferri-siderophore uptake genes
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
dhbACEBF dhbA SigA Negative 3292363..3292412 +7:+22 TTATTTTTATAATTGATAATGATAATCATTATCAATAGATTGCGTTTTTC Baichoo N, et al. (2002): FT
Ollinger J, et al. (2006): DB SDS-PAGE
feuABC-ybbA feuA SigA Negative 183323..183372 -11:+39 CTATAATTCCAATTGATAATAGTTATCAATTGAACAGGAGGCTCTATAGA Baichoo N, et al. (2002): FT
Ollinger J, et al. (2006): DB SDS-PAGE
fhuD fhuD None Negative 3418409..3418458 None GTGGTATAATCACAGATGATAATGATTCTCTTTTTCATCTATCTTTTAGA Baichoo N, et al. (2002): FT
nasBCDEF nasE None Negative 355733..355782 None TGTCGTGACCACATCATAATGACAAAAACTATCATTGAGGAGGAATGGAC Baichoo N, et al. (2002): FT
ybbB ybbB None Negative 185018..185067 None TATTTGGTACAATTTTTATTGAAAATGATTATCAATTGAAAGCTTCTGAA Baichoo N, et al. (2002): FT
ycgT ycgT None Negative 352789..352829 None GATATACTTTGTATTGATATTCATTCTCAATTAAAACTTTG Ollinger J, et al. (2006): DB 2D-PAGE RG GS HM
yclNOPQ yclN None Negative 432263..432312 None GGTAATATGTAAATGATAATGATAATCAATTACTATATGGCCATATTGTT Baichoo N, et al. (2002): FT
Ollinger J, et al. (2006): DB SDS-PAGE
ydbN ydbN None Negative 506627..506676 None TACTGAAGTTAATTGATAATGATTATCAATATCGTTTGATTGGAGGTTGG Baichoo N, et al. (2002): FT
ydhU ydhU None Negative 634424..634473 None AAGCGGTTAAACATGCTAATCCTCATCATTATATTATTGGAGCGCAAAGT Baichoo N, et al. (2002): FT
yfhC yfhC None Negative 923530..923579 None TTCCGTTATCATTATGAAATGATAATCATTTTCAATTGCATAGGAAGGTG Baichoo N, et al. (2002): FT
yfiY yfiY None Negative ND ND ND Baichoo N, et al. (2002): AR
Ollinger J, et al. (2006): DB SDS-PAGE
yfiZ-yfhA yfiZ None Negative 920404..920451 None TGTCAATCCCTAATTGAGGATTATTCTCAAAAACAAACATTACATAGT Baichoo N, et al. (2002): FT
yfiZ-yfhA yfiZ None Negative 920339..920388 None TTCATCTTTTTCCTCCCAATATTGAAATTCATTATCATTTAGATCATAAT Baichoo N, et al. (2002): FT
yfkM yfkM None Negative 859408..859457 None GGTGGTGTTGGGAGGATTAGGCTAAGTATCATAATTGGGGGCAAAAGAAT Baichoo N, et al. (2002): FT
yfmCDEF yfmC None Negative 826742..826791 None ATAGTGTTACATGTGATAATGATTCTCATTACTAAATCTGAAAAAAGGAA Baichoo N, et al. (2002): FT
yhfQ yhfQ None Negative 1107640..1107689 None TAAAAATAATTGGTGATAATGATTCTCATTCCGTGTTATACTACTCTTGG Baichoo N, et al. (2002): FT
ykuNOP ykuN SigA Negative 1486950..1486991 -47:-6 TTTATTTATCTGTTGACAATGAAAATCATTATCATTTAAAGT Baichoo N, et al. (2002): FT
ykuNOP ykuN SigA Negative 1486987..1487028 -10:+32 AAAGTGATACATATGATATTGAAAATCATTATCAACTAATGG Baichoo N, et al. (2002): FT
yoaJ yoaJ None Negative 2033639..2033688 None GATGGATTGAGTCTTATAATGATAATGATTCTCATTTGAAGTCTGGTTTG Baichoo N, et al. (2002): FT
Ollinger J, et al. (2006): DB SDS-PAGE
mrgC ypbR None Negative ND ND ND Chen L, et al. (1993): RG HM
Bsat N, et al. (1998): RG
yuiI yuiI None Negative 3293384..3293433 None TGAGGTGTCTAGTTGATAGTGAAAATCATTATCATACATTGCGGTTTAGT Baichoo N, et al. (2002): FT
yusV yusV None Negative 3380074..3380121 None CCATAAAACTAATTGAAAATGATTTTCAAAGTCAGTGTTTTCTGCTAC Baichoo N, et al. (2002): FT
yusV yusV None Negative 3380007..3380056 None CATATCAAATGGCTGAATATCGGAATCATTTGCATTGATGACAATTGACT Baichoo N, et al. (2002): FT
ywbLMN ywbL None Negative 3930552..3930601 None CTATGATTATGTTATACAATGATAATCATTTTCAATTATAGGAGGAACAT Baichoo N, et al. (2002): FT
Ollinger J, et al. (2006): DB SDS-PAGE
ywjA ywjA None Negative 3821494..3821543 None CAGCCCGTGTATAGTATAATTGAGAAATATTATCAGTTATTTATACATTG Baichoo N, et al. (2002): FT
yxeB yxeB None Negative 4067117..4067166 None CTATATTATTAATTGATAATGATAATCATTACTAATCTATTGAGATACAT Baichoo N, et al. (2002): FT
Ollinger J, et al. (2006): DB SDS-PAGE




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai