 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yclF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yclF | - | 415803..417281 |
| Operon evidence: | upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Hpr | Positive | ND | 417769..417797 | AATGAGTATAAATTATATTGACACAAGTA |
Caldwell R, et al. (2001): AR HM |
| Hpr | Positive | ND | 417741..417769 | ATTATATAAGAATATGATTTTTATAATAC |
Caldwell R, et al. (2001): AR HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGAAACAGCCCGCGGATGTTGATCTGCGGGCTGTTTTTTATTGATCAA >>>>>>>>>>>> <<<<<<<<<<<< |
yclF |
|