| Regulated Operon: | ydaP |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ydaP | + | 488830..490554 | COG0028EH |
| Operon evidence: | Northern blotting (1.8 kb transcript) |
|---|---|
| Reference: | Petersohn A, et al. (1999) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -39:+4 | 488772..488814 | TCCGGGTTTTAAAGCCTTTCTCCTGTGGTATTGAAAAAAGGAA |
Petersohn A, et al. (1999): PE NB 2D-gel |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAACAGGGGCCCTAAGAGCCCTTGTTTTTTTTTTTTTTTT >>>>>>>> <<<<<<<< |
ydaP |


|